MD10G1056100.v1.1
MADS Family

MADS-box transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
OG0011645
Physical Location & Seq
Forward (+)
7685645 .. 7690319
4675 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1056100.v1.1.491

Sequence Viewer

Length: 339 bp
ATGAAATCAGTTATCGATCGTTTCAACAAACTGAAAGTGGAGCATCAACTGCTGAATCCTGCTTCAGAAGTCAAGTTTTGGCAAAGGGAAGCAACAAGCTTGAGGCAACAATTGCGGTACTTGGAAGAATGTCACAGGCAGTTAATGGGGGAAGAACTTTCTGGTTTGAGTGCCAATGATCTACAAAATTTGGAAAGTCAGCTTGAGATGAGTTTGAAAGGTGTCCGAACGAAAAAGGGATCTTTCATACATCAAGAGAATATAGAACTGCATAAGAAGCTAGACCTCGTAAGTAAAGAGAATGAGAAACTGCAAAAGAAGGTATTGTCTATACAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
K-box SRF-TF

Protein Analysis

113

Amino Acids

13.14

Weight (kDa)

9.07

Isoelectric Point (pI)

52.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
K-box PF01486 21 - 108 5.6e-24 K-box region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 115
AclWI GGATC 1 cut(s) 247
AcsI RAATTY 1 cut(s) 187
AcuI CTGAAG 1 cut(s) 48
AfaI GTAC 1 cut(s) 119
AgsI TTSAA 2 cut(s) 25, 217
AluBI AGCT 3 cut(s) 99, 202, 280
AluI AGCT 3 cut(s) 99, 202, 280
AlwI GGATC 1 cut(s) 247
ApoI RAATTY 1 cut(s) 187
BfaI CTAG 1 cut(s) 281
BmsI GCATC 1 cut(s) 52
BpuEI CTTGAG 2 cut(s) 121, 224
Bsa29I ATCGAT 1 cut(s) 15
BseCI ATCGAT 1 cut(s) 15
Bsh1285I CGRYCG 1 cut(s) 19
BshVI ATCGAT 1 cut(s) 15
BsiEI CGRYCG 1 cut(s) 19
Bsp143I GATC 3 cut(s) 16, 178, 239
BspACI CCGC 1 cut(s) 115
BspDI ATCGAT 1 cut(s) 15
BspPI GGATC 1 cut(s) 247
BssMI GATC 3 cut(s) 16, 178, 239
BstAPI GCANNNNNTGC 2 cut(s) 49, 112
BstKTI GATC 3 cut(s) 19, 181, 242
BstMBI GATC 3 cut(s) 16, 178, 239
BstMCI CGRYCG 1 cut(s) 19
BstMWI GCNNNNNNNGC 3 cut(s) 49, 112, 277
BstX2I RGATCY 1 cut(s) 239
BstYI RGATCY 1 cut(s) 239
Bsu15I ATCGAT 1 cut(s) 15
BsuTUI ATCGAT 1 cut(s) 15
ClaI ATCGAT 1 cut(s) 15
Csp6I GTAC 1 cut(s) 118
CviJI RGCY 3 cut(s) 99, 202, 280
CviKI_1 RGCY 3 cut(s) 99, 202, 280
CviQI GTAC 1 cut(s) 118
DpnI GATC 3 cut(s) 18, 180, 241
DpnII GATC 3 cut(s) 16, 178, 239
Eco57I CTGAAG 1 cut(s) 48
FaiI YATR 4 cut(s) 248, 263, 273, 332
FspBI CTAG 1 cut(s) 281
HindIII AAGCTT 1 cut(s) 97
HinfI GANTC 1 cut(s) 55
Hpy188I TCNGA 2 cut(s) 67, 227
Hpy188III TCNNGA 1 cut(s) 254
HpyAV CCTTC 1 cut(s) 313
HpyCH4V TGCA 2 cut(s) 271, 313
HpyF10VI GCNNNNNNNGC 3 cut(s) 49, 112, 277
Kzo9I GATC 3 cut(s) 16, 178, 239
LmnI GCTCC 1 cut(s) 40
LpnPI CCDG 3 cut(s) 72, 121, 147
LweI GCATC 1 cut(s) 52
MaeI CTAG 1 cut(s) 281
MaeIII GTNAC 1 cut(s) 131
MalI GATC 3 cut(s) 18, 180, 241
MboI GATC 3 cut(s) 16, 178, 239
MboII GAAGA 2 cut(s) 137, 164
MfeI CAATTG 1 cut(s) 110
MflI RGATCY 1 cut(s) 239
MluCI AATT 2 cut(s) 110, 187
MnlI CCTC 2 cut(s) 96, 296
MseI TTAA 1 cut(s) 143
MunI CAATTG 1 cut(s) 110
MwoI GCNNNNNNNGC 3 cut(s) 49, 112, 277
NdeII GATC 3 cut(s) 16, 178, 239
NmuCI GTSAC 1 cut(s) 131
PfeI GAWTC 1 cut(s) 55
Ple19I CGATCG 1 cut(s) 19
PsuI RGATCY 1 cut(s) 239
PvuI CGATCG 1 cut(s) 19
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
SaqAI TTAA 1 cut(s) 143
Sau3AI GATC 3 cut(s) 16, 178, 239
SetI ASST 6 cut(s) 101, 204, 223, 282, 288, 324
SfaNI GCATC 1 cut(s) 52
SmlI CTYRAG 2 cut(s) 100, 203
SmoI CTYRAG 2 cut(s) 100, 203
Sse9I AATT 2 cut(s) 110, 187
SsiI CCGC 1 cut(s) 115
SspMI CTAG 1 cut(s) 281
TaqI TCGA 1 cut(s) 15
TasI AATT 2 cut(s) 110, 187
TfiI GAWTC 1 cut(s) 55
Tru1I TTAA 1 cut(s) 143
Tru9I TTAA 1 cut(s) 143
TseFI GTSAC 1 cut(s) 131
Tsp45I GTSAC 1 cut(s) 131
TspDTI ATGAA 2 cut(s) 17, 235
XapI RAATTY 1 cut(s) 187
XspI CTAG 1 cut(s) 281
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.