Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6D

Orthogroup ID

OG0011645

Physical Location & Seq

Genomic Coordinates Reverse (-)

24419938 .. 24470972

Gene Structure 51035 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6DG162500.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 582 bp

ATGGCCACTAAGCACAGCCGATTGGAGATTGAGTTAAAACCCACCCCATTGTCAACCACCCCTGTAAAAAGATGGAGCATCACATATTCACATCCTAATTTGATTGTGGTGCTATTTGATTTTGCTTATGAACATCTTTGTTTTTCCGATCCCCCGAACCCGCTTTTGAACAGCATTTTGCCGAGGGCAAATAGGGAAAAGCAGCCAATTTTGGGAAAGGGAGGCAGCAAGCTTGAGACAACAATTGCAGTACTTGCAAGAATGCCACAGGACCAGATATTAAATGAAGAAATAAAAGACCTAAGCCAGAAGGGAAATCTCATACATCAAGAGAACATAGAACTGTATAAGAAGCTAGACGTCATAGGTAAAGAGAATGTGGAACTCCAAAGAAAGGCCTATGGAGCAAGGAATGTGAATGAAGAAAACGAAAGCTCCGAACCTTCGTTTACCATTACTAATGGATATCAATTGCATGCACCCATCCATCTGCAGCTAAGCCAGCCACAGAATCAAACTGAGCCTCAGCCTCAGAACAATGTACCAGCAAATGCAATCAAACTAGGATTGCATCTGCACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

K-box SRF-TF

Protein Analysis

193

Amino Acids

21.83

Weight (kDa)

6.71

Isoelectric Point (pI)

54.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011645)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G14210 AT2G14210
fragaria_vesca	FvH4_2g11352
malus_domestica	MD05G1049500.v1.1 MD10G1056100.v1.1 MD10G1056200.v1.1
prunus_persica	Prupe.8G073700_v2.0.a1 Prupe.8G073700_v2.0.a1 Prupe.8G073700_v2.0.a1
pyrus_communis	pycom05g04090 pycom10g04310 pycom10g04320
rosa_chinensis	RchiOBHm_Chr6g0269991
rosa_laevigata	RLG00000013823
rosa_multiflora	Rmu_sc0000893.1_g000023
rosa_roxburghii	Rroxscaffold_7G00198220
rosa_rugosa	Rorug06G0051800
rosa_samantha	Rh6AG170900 Rh6DG162500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	363
AciI	CCGC	1 cut(s)	161
AclWI	GGATC	1 cut(s)	143
AcoI	YGGCCR	1 cut(s)	3
AcyI	GRCGYC	1 cut(s)	360
AfaI	GTAC	2 cut(s)	252, 543
AfiI	CCNNNNNNNGG	2 cut(s)	212, 394
AgsI	TTSAA	1 cut(s)	169
AluBI	AGCT	4 cut(s)	232, 355, 435, 496
AluI	AGCT	4 cut(s)	232, 355, 435, 496
Alw26I	GTCTC	1 cut(s)	230
AlwI	GGATC	1 cut(s)	143
AoxI	GGCC	2 cut(s)	3, 396
ApeKI	GCWGC	3 cut(s)	202, 225, 493
AspS9I	GGNCC	1 cut(s)	271
AvaII	GGWCC	1 cut(s)	271
BalI	TGGCCA	1 cut(s)	5
BbvCI	CCTCAGC	1 cut(s)	525
BbvI	GCAGC	3 cut(s)	214, 237, 505
BccI	CCATC	3 cut(s)	66, 491, 495
BcoDI	GTCTC	1 cut(s)	230
BfaI	CTAG	3 cut(s)	356, 563, 580
BfmI	CTRYAG	1 cut(s)	491
BisI	GCNGC	3 cut(s)	203, 226, 494
BlpI	GCTNAGC	1 cut(s)	497
BlsI	GCNGC	3 cut(s)	204, 227, 495
BmcAI	AGTACT	1 cut(s)	252
Bme18I	GGWCC	1 cut(s)	271
BmgT120I	GGNCC	1 cut(s)	271
BmsI	GCATC	1 cut(s)	87
Bpu10I	CCTNAGC	2 cut(s)	302, 525
Bpu1102I	GCTNAGC	1 cut(s)	497
BpuEI	CTTGAG	1 cut(s)	254
BsaHI	GRCGYC	1 cut(s)	360
BsaJI	CCNNGG	1 cut(s)	182
BsaXI	ACNNNNNCTCC	4 cut(s)	17, 47, 419, 449
Bsc4I	CCNNNNNNNGG	2 cut(s)	212, 394
BseDI	CCNNGG	1 cut(s)	182
BseGI	GGATG	2 cut(s)	91, 483
BseLI	CCNNNNNNNGG	2 cut(s)	212, 394
BseMII	CTCAG	3 cut(s)	510, 539, 545
BseXI	GCAGC	3 cut(s)	214, 237, 505
BsgI	GTGCAG	1 cut(s)	560
BshFI	GGCC	2 cut(s)	5, 398
BslI	CCNNNNNNNGG	2 cut(s)	212, 394
BsmAI	GTCTC	1 cut(s)	230
BsmI	GAATGC	1 cut(s)	267
BsnI	GGCC	2 cut(s)	5, 398
Bsp143I	GATC	1 cut(s)	148
Bsp1720I	GCTNAGC	1 cut(s)	497
BspACI	CCGC	1 cut(s)	161
BspANI	GGCC	2 cut(s)	5, 398
BspCNI	CTCAG	3 cut(s)	511, 538, 544
BspMAI	CTGCAG	1 cut(s)	495
BspPI	GGATC	1 cut(s)	143
BssECI	CCNNGG	1 cut(s)	182
BssMI	GATC	1 cut(s)	148
BssNI	GRCGYC	1 cut(s)	360
Bst4CI	ACNGT	1 cut(s)	345
BstACI	GRCGYC	1 cut(s)	360
BstAPI	GCANNNNNTGC	1 cut(s)	254
BstC8I	GCNNGC	3 cut(s)	230, 477, 503
BstDEI	CTNAG	6 cut(s)	9, 302, 497, 519, 525, 531
BstF5I	GGATG	2 cut(s)	91, 483
BstKTI	GATC	1 cut(s)	151
BstMAI	GTCTC	1 cut(s)	230
BstMBI	GATC	1 cut(s)	148
BstMWI	GCNNNNNNNGC	3 cut(s)	254, 404, 502
BstNSI	RCATGY	1 cut(s)	479
BstSFI	CTRYAG	1 cut(s)	491
BstV1I	GCAGC	3 cut(s)	214, 237, 505
BsuRI	GGCC	2 cut(s)	5, 398
BtsCI	GGATG	2 cut(s)	91, 483
Cac8I	GCNNGC	3 cut(s)	230, 477, 503
Cfr13I	GGNCC	1 cut(s)	271
Csp6I	GTAC	2 cut(s)	251, 542
CviAII	CATG	1 cut(s)	476
CviQI	GTAC	2 cut(s)	251, 542
DdeI	CTNAG	6 cut(s)	9, 302, 497, 519, 525, 531
DpnI	GATC	1 cut(s)	150
DpnII	GATC	1 cut(s)	148
EaeI	YGGCCR	1 cut(s)	3
Eco147I	AGGCCT	1 cut(s)	398
Eco32I	GATATC	1 cut(s)	467
Eco47I	GGWCC	1 cut(s)	271
EcoRV	GATATC	1 cut(s)	467
FaeI	CATG	1 cut(s)	479
FaiI	YATR	8 cut(s)	85, 129, 323, 338, 348, 365, 402, 477
FatI	CATG	1 cut(s)	475
FauI	CCCGC	1 cut(s)	168
Fnu4HI	GCNGC	3 cut(s)	203, 226, 494
FokI	GGATG	2 cut(s)	78, 470
Fsp4HI	GCNGC	3 cut(s)	203, 226, 494
FspBI	CTAG	3 cut(s)	356, 563, 580
GluI	GCNGC	3 cut(s)	203, 226, 494
HaeIII	GGCC	2 cut(s)	5, 398
Hin1I	GRCGYC	1 cut(s)	360
Hin1II	CATG	1 cut(s)	479
HincII	GTYRAC	1 cut(s)	54
HindII	GTYRAC	1 cut(s)	54
HindIII	AAGCTT	1 cut(s)	230
HinfI	GANTC	1 cut(s)	511
Hpy166II	GTNNAC	2 cut(s)	54, 450
Hpy188I	TCNGA	3 cut(s)	148, 439, 534
Hpy188III	TCNNGA	1 cut(s)	329
Hpy8I	GTNNAC	2 cut(s)	54, 450
HpyAV	CCTTC	2 cut(s)	304, 453
HpyCH4III	ACNGT	1 cut(s)	345
HpyCH4IV	ACGT	1 cut(s)	360
HpyCH4V	TGCA	8 cut(s)	248, 257, 475, 479, 493, 554, 571, 577
HpyF10VI	GCNNNNNNNGC	3 cut(s)	254, 404, 502
HpyF3I	CTNAG	6 cut(s)	9, 302, 497, 519, 525, 531
HpySE526I	ACGT	1 cut(s)	360
Hsp92I	GRCGYC	1 cut(s)	360
Hsp92II	CATG	1 cut(s)	479
Kzo9I	GATC	1 cut(s)	148
LmnI	GCTCC	3 cut(s)	75, 404, 440
LpnPI	CCDG	6 cut(s)	75, 254, 287, 320, 515, 558
Lsp1109I	GCAGC	3 cut(s)	214, 237, 505
LweI	GCATC	1 cut(s)	87
MaeI	CTAG	3 cut(s)	356, 563, 580
MaeII	ACGT	1 cut(s)	360
MalI	GATC	1 cut(s)	150
MboI	GATC	1 cut(s)	148
MboII	GAAGA	2 cut(s)	299, 434
MfeI	CAATTG	2 cut(s)	243, 470
MlsI	TGGCCA	1 cut(s)	5
MluCI	AATT	4 cut(s)	97, 207, 243, 470
MluNI	TGGCCA	1 cut(s)	5
MnlI	CCTC	4 cut(s)	177, 215, 534, 540
Mox20I	TGGCCA	1 cut(s)	5
MscI	TGGCCA	1 cut(s)	5
MseI	TTAA	2 cut(s)	35, 281
Msp20I	TGGCCA	1 cut(s)	5
MunI	CAATTG	2 cut(s)	243, 470
Mva1269I	GAATGC	1 cut(s)	267
MwoI	GCNNNNNNNGC	3 cut(s)	254, 404, 502
NdeII	GATC	1 cut(s)	148
NlaIII	CATG	1 cut(s)	479
NmeAIII	GCCGAG	1 cut(s)	207
NspI	RCATGY	1 cut(s)	479
PaeI	GCATGC	1 cut(s)	479
PceI	AGGCCT	1 cut(s)	398
PcsI	WCGNNNNNNNCGW	1 cut(s)	435
PctI	GAATGC	1 cut(s)	267
PfeI	GAWTC	1 cut(s)	511
PkrI	GCNGC	3 cut(s)	204, 227, 495
PspPI	GGNCC	1 cut(s)	271
PstI	CTGCAG	1 cut(s)	495
RsaI	GTAC	2 cut(s)	252, 543
RsaNI	GTAC	2 cut(s)	251, 542
SaqAI	TTAA	2 cut(s)	35, 281
SatI	GCNGC	3 cut(s)	203, 226, 494
Sau3AI	GATC	1 cut(s)	148
Sau96I	GGNCC	1 cut(s)	271
ScaI	AGTACT	1 cut(s)	252
SetI	ASST	8 cut(s)	234, 303, 357, 363, 370, 437, 445, 498
SfaNI	GCATC	1 cut(s)	87
SfcI	CTRYAG	1 cut(s)	491
SinI	GGWCC	1 cut(s)	271
SmlI	CTYRAG	1 cut(s)	233
SmoI	CTYRAG	1 cut(s)	233
SphI	GCATGC	1 cut(s)	479
Sse9I	AATT	4 cut(s)	97, 207, 243, 470
SseBI	AGGCCT	1 cut(s)	398
SsiI	CCGC	1 cut(s)	161
SspMI	CTAG	3 cut(s)	356, 563, 580
StuI	AGGCCT	1 cut(s)	398
TaaI	ACNGT	1 cut(s)	345
TaiI	ACGT	1 cut(s)	363
TasI	AATT	4 cut(s)	97, 207, 243, 470
TatI	WGTACW	1 cut(s)	250
TfiI	GAWTC	1 cut(s)	511
Tru1I	TTAA	2 cut(s)	35, 281
Tru9I	TTAA	2 cut(s)	35, 281
TseI	GCWGC	3 cut(s)	202, 225, 493
TspDTI	ATGAA	3 cut(s)	144, 300, 435
VpaK11BI	GGWCC	1 cut(s)	271
XceI	RCATGY	1 cut(s)	479
XspI	CTAG	3 cut(s)	356, 563, 580
ZraI	GACGTC	1 cut(s)	361
ZrmI	AGTACT	1 cut(s)	252

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.