pycom10g04310
MADS Family

MADS-box transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
OG0011645
Physical Location & Seq
Forward (+)
4553669 .. 4554328
660 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g04310.1

Sequence Viewer

Length: 252 bp
ATGCAACTTTGTAAAAATCTGTACCCTCACACCTTCTGTAAATTATGCAGGCAGTTAATAGGGGAAGAACTTTCTGGTTTGAGCGCCAAAGATCTACAGAATTTGGAAAGCCAACTTGAGATGAGTTTGAAAGGTGTCCGAATGAAAAAGGGATCTTTCATTCATCAAGAGAATATAAAACTGCATAAGAACCTAGACCTCGTAAGTAAAGAGAATAAGGAACTGCAAAAGAAGGTATTGTCTATACATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
K-box SRF-TF

Protein Analysis

84

Amino Acids

9.61

Weight (kDa)

9.27

Isoelectric Point (pI)

43.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
K-box PF01486 16 - 79 1.1e-16 K-box region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 160
AcsI RAATTY 1 cut(s) 100
AfaI GTAC 1 cut(s) 23
AgsI TTSAA 1 cut(s) 130
AlwI GGATC 1 cut(s) 160
ApoI RAATTY 1 cut(s) 100
AspLEI GCGC 1 cut(s) 86
BfaI CTAG 1 cut(s) 194
BfmI CTRYAG 1 cut(s) 95
BfoI RGCGCY 1 cut(s) 87
BglII AGATCT 1 cut(s) 91
BpuEI CTTGAG 1 cut(s) 137
Bsp143I GATC 2 cut(s) 91, 152
BspPI GGATC 1 cut(s) 160
BssMI GATC 2 cut(s) 91, 152
BstC8I GCNNGC 1 cut(s) 50
BstH2I RGCGCY 1 cut(s) 87
BstHHI GCGC 1 cut(s) 86
BstKTI GATC 2 cut(s) 94, 155
BstMBI GATC 2 cut(s) 91, 152
BstSFI CTRYAG 1 cut(s) 95
BstX2I RGATCY 2 cut(s) 91, 152
BstYI RGATCY 2 cut(s) 91, 152
Cac8I GCNNGC 1 cut(s) 50
CfoI GCGC 1 cut(s) 86
Csp6I GTAC 1 cut(s) 22
CviJI RGCY 1 cut(s) 111
CviKI_1 RGCY 1 cut(s) 111
CviQI GTAC 1 cut(s) 22
DpnI GATC 2 cut(s) 93, 154
DpnII GATC 2 cut(s) 91, 152
FaiI YATR 4 cut(s) 46, 176, 186, 245
FspBI CTAG 1 cut(s) 194
GlaI GCGC 1 cut(s) 85
HaeII RGCGCY 1 cut(s) 87
HhaI GCGC 1 cut(s) 86
Hin6I GCGC 1 cut(s) 84
HinP1I GCGC 1 cut(s) 84
Hpy188I TCNGA 1 cut(s) 140
Hpy188III TCNNGA 1 cut(s) 167
HpyAV CCTTC 2 cut(s) 43, 226
HpyCH4V TGCA 4 cut(s) 4, 48, 184, 226
HspAI GCGC 1 cut(s) 84
Kzo9I GATC 2 cut(s) 91, 152
LpnPI CCDG 2 cut(s) 34, 60
MaeI CTAG 1 cut(s) 194
MalI GATC 2 cut(s) 93, 154
MboI GATC 2 cut(s) 91, 152
MboII GAAGA 1 cut(s) 77
MflI RGATCY 2 cut(s) 91, 152
MluCI AATT 2 cut(s) 41, 100
MnlI CCTC 2 cut(s) 36, 209
MseI TTAA 2 cut(s) 56, 250
NdeII GATC 2 cut(s) 91, 152
PsuI RGATCY 2 cut(s) 91, 152
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
SaqAI TTAA 2 cut(s) 56, 250
Sau3AI GATC 2 cut(s) 91, 152
SetI ASST 5 cut(s) 35, 136, 195, 201, 237
SfcI CTRYAG 1 cut(s) 95
SgeI CNNG 6 cut(s) 61, 87, 128, 179, 206, 212
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
Sse9I AATT 2 cut(s) 41, 100
SspMI CTAG 1 cut(s) 194
TasI AATT 2 cut(s) 41, 100
Tru1I TTAA 2 cut(s) 56, 250
Tru9I TTAA 2 cut(s) 56, 250
TspDTI ATGAA 3 cut(s) 148, 152, 158
XapI RAATTY 1 cut(s) 100
XspI CTAG 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.