FvH4_3g25860

Protein of unknown function (DUF788)

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Forward (+)
18704839 .. 18710122
5284 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g25860.t1

Sequence Viewer

Length: 522 bp
ATGGCAAATCAAGGAGCAAAAAAGCGCAAGGAAGAGAATGCTCGGCACATGGCTAATATTCGTCGCTTGATTCTGGCCTGCAATGTGATTTATGTGGTAGTAAGGATGCTCATCTTCCATTCTACTTTTACCTGGAAAAACTGGGTTGCTTTGCTGCTGACATCTGTAGCTTATTATATTCCTTATCAACAACTCACCCAAATGGCAAAACCTTCTTATTCTGATGATGGTGAGCTTCTAGACGGTGGATTTGATATGTCCACTGGTGGAGTTTGTGGCTATTTACATGATGTAATCTACATTACAAGCTTCGTGCAAGTCATGTCCATAATCTCTGGAAAATTTTGGTACACGTATTTGCTGATACCAGGTTTTGGAGCATACAAATCATTTGGTTTCTTTAGAGGATTTATGTCCCAAGGTCCAGAGGGAGGCGTGGAGGATGAAAAGACACGAAAGAAGAGGGAAAAGATGGAGAAGAAGGCATCAAGACCACAGTTTGTCAAGACAAGAAACAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

174

Amino Acids

19.91

Weight (kDa)

9.72

Isoelectric Point (pI)

43.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TMEM208_SND2 PF05620 1 - 162 4.6e-58 SRP-independent targeting protein 2/TMEM208
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 374
AcsI RAATTY 1 cut(s) 341
AfaI GTAC 1 cut(s) 350
AfiI CCNNNNNNNGG 2 cut(s) 374, 431
AflIII ACRYGT 1 cut(s) 351
AjnI CCWGG 2 cut(s) 131, 367
AluBI AGCT 3 cut(s) 170, 235, 309
AluI AGCT 3 cut(s) 170, 235, 309
AoxI GGCC 1 cut(s) 75
ApeKI GCWGC 1 cut(s) 154
ApoI RAATTY 1 cut(s) 341
ArsI GACNNNNNNTTYG 2 cut(s) 233, 265
AspLEI GCGC 1 cut(s) 27
AspS9I GGNCC 1 cut(s) 422
AsuHPI GGTGA 2 cut(s) 187, 242
AvaII GGWCC 1 cut(s) 422
BbvI GCAGC 1 cut(s) 141
BccI CCATC 2 cut(s) 221, 466
BciT130I CCWGG 2 cut(s) 133, 369
BfaI CTAG 1 cut(s) 239
BfmI CTRYAG 1 cut(s) 165
BisI GCNGC 1 cut(s) 155
BlsI GCNGC 1 cut(s) 156
Bme1390I CCNGG 2 cut(s) 133, 369
Bme18I GGWCC 1 cut(s) 422
BmgT120I GGNCC 1 cut(s) 422
BmrFI CCNGG 2 cut(s) 133, 369
BmrI ACTGGG 1 cut(s) 151
BmsI GCATC 2 cut(s) 96, 494
BmuI ACTGGG 1 cut(s) 151
BsaAI YACGTR 1 cut(s) 354
BsaBI GATNNNNATC 1 cut(s) 110
BsaJI CCNNGG 1 cut(s) 418
Bsc4I CCNNNNNNNGG 2 cut(s) 374, 431
Bse1I ACTGG 2 cut(s) 146, 268
Bse3DI GCAATG 1 cut(s) 88
Bse8I GATNNNNATC 1 cut(s) 110
BseBI CCWGG 2 cut(s) 133, 369
BseDI CCNNGG 1 cut(s) 418
BseGI GGATG 2 cut(s) 111, 448
BseJI GATNNNNATC 1 cut(s) 110
BseLI CCNNNNNNNGG 2 cut(s) 374, 431
BseMI GCAATG 1 cut(s) 88
BseNI ACTGG 2 cut(s) 146, 268
BseXI GCAGC 1 cut(s) 141
BshFI GGCC 1 cut(s) 77
BslFI GGGAC 1 cut(s) 400
BslI CCNNNNNNNGG 2 cut(s) 374, 431
BsmFI GGGAC 1 cut(s) 400
BsmI GAATGC 1 cut(s) 43
BsnI GGCC 1 cut(s) 77
BspANI GGCC 1 cut(s) 77
BsrDI GCAATG 1 cut(s) 88
BsrI ACTGG 2 cut(s) 146, 268
BssECI CCNNGG 1 cut(s) 418
BssT1I CCWWGG 1 cut(s) 418
Bst2UI CCWGG 2 cut(s) 133, 369
Bst4CI ACNGT 2 cut(s) 245, 498
Bst6I CTCTTC 2 cut(s) 27, 455
BstBAI YACGTR 1 cut(s) 354
BstC8I GCNNGC 1 cut(s) 79
BstF5I GGATG 2 cut(s) 111, 448
BstHHI GCGC 1 cut(s) 27
BstNI CCWGG 2 cut(s) 133, 369
BstSCI CCNGG 2 cut(s) 131, 367
BstSFI CTRYAG 1 cut(s) 165
BstV1I GCAGC 1 cut(s) 141
BsuRI GGCC 1 cut(s) 77
BtsCI GGATG 2 cut(s) 111, 448
BtsIMutI CAGTG 1 cut(s) 261
Cac8I GCNNGC 1 cut(s) 79
CfoI GCGC 1 cut(s) 27
Cfr13I GGNCC 1 cut(s) 422
CsiI ACCWGGT 1 cut(s) 367
Csp6I GTAC 1 cut(s) 349
CviAII CATG 3 cut(s) 49, 287, 322
CviJI RGCY 6 cut(s) 53, 77, 170, 235, 279, 309
CviKI_1 RGCY 6 cut(s) 53, 77, 170, 235, 279, 309
CviQI GTAC 1 cut(s) 349
Eam1104I CTCTTC 2 cut(s) 27, 455
EarI CTCTTC 2 cut(s) 27, 455
Eco130I CCWWGG 1 cut(s) 418
Eco47I GGWCC 1 cut(s) 422
EcoRII CCWGG 2 cut(s) 131, 367
EcoT14I CCWWGG 1 cut(s) 418
ErhI CCWWGG 1 cut(s) 418
FaeI CATG 3 cut(s) 52, 290, 325
FaiI YATR 9 cut(s) 50, 93, 177, 257, 288, 323, 329, 382, 413
FaqI GGGAC 1 cut(s) 400
FatI CATG 3 cut(s) 48, 286, 321
Fnu4HI GCNGC 1 cut(s) 155
FokI GGATG 2 cut(s) 118, 455
Fsp4HI GCNGC 1 cut(s) 155
FspBI CTAG 1 cut(s) 239
GlaI GCGC 1 cut(s) 26
GluI GCNGC 1 cut(s) 155
HaeIII GGCC 1 cut(s) 77
HhaI GCGC 1 cut(s) 27
Hin1II CATG 3 cut(s) 52, 290, 325
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HindIII AAGCTT 1 cut(s) 307
HinfI GANTC 1 cut(s) 70
HphI GGTGA 2 cut(s) 187, 242
Hpy166II GTNNAC 2 cut(s) 261, 351
Hpy188I TCNGA 1 cut(s) 223
Hpy188III TCNNGA 5 cut(s) 239, 336, 425, 489, 505
Hpy8I GTNNAC 2 cut(s) 261, 351
Hpy99I CGWCG 1 cut(s) 66
HpyAV CCTTC 2 cut(s) 222, 475
HpyCH4III ACNGT 2 cut(s) 245, 498
HpyCH4IV ACGT 1 cut(s) 353
HpyCH4V TGCA 2 cut(s) 81, 316
HpySE526I ACGT 1 cut(s) 353
Hsp92II CATG 3 cut(s) 52, 290, 325
HspAI GCGC 1 cut(s) 25
LmnI GCTCC 2 cut(s) 14, 377
Lsp1109I GCAGC 1 cut(s) 141
LweI GCATC 2 cut(s) 96, 494
MabI ACCWGGT 1 cut(s) 367
MaeI CTAG 1 cut(s) 239
MaeII ACGT 1 cut(s) 353
MboII GAAGA 4 cut(s) 44, 106, 472, 490
MluCI AATT 1 cut(s) 341
MnlI CCTC 5 cut(s) 398, 421, 425, 433, 456
MslI CAYNNNNRTG 1 cut(s) 200
MspR9I CCNGG 2 cut(s) 133, 369
Mva1269I GAATGC 1 cut(s) 43
MvaI CCWGG 2 cut(s) 133, 369
NlaIII CATG 3 cut(s) 52, 290, 325
NmeAIII GCCGAG 1 cut(s) 22
PctI GAATGC 1 cut(s) 43
PfeI GAWTC 1 cut(s) 70
PflMI CCANNNNNTGG 1 cut(s) 374
PkrI GCNGC 1 cut(s) 156
Ppu21I YACGTR 1 cut(s) 354
Psp6I CCWGG 2 cut(s) 131, 367
PspGI CCWGG 2 cut(s) 131, 367
PspPI GGNCC 1 cut(s) 422
RsaI GTAC 1 cut(s) 350
RsaNI GTAC 1 cut(s) 349
RseI CAYNNNNRTG 1 cut(s) 200
SatI GCNGC 1 cut(s) 155
Sau96I GGNCC 1 cut(s) 422
ScrFI CCNGG 2 cut(s) 133, 369
SetI ASST 8 cut(s) 134, 172, 214, 237, 311, 356, 373, 424
SexAI ACCWGGT 1 cut(s) 367
SfaNI GCATC 2 cut(s) 96, 494
SfcI CTRYAG 1 cut(s) 165
SinI GGWCC 1 cut(s) 422
SmiMI CAYNNNNRTG 1 cut(s) 200
Sse9I AATT 1 cut(s) 341
SspI AATATT 1 cut(s) 58
SspMI CTAG 1 cut(s) 239
StyD4I CCNGG 2 cut(s) 131, 367
StyI CCWWGG 1 cut(s) 418
TaaI ACNGT 2 cut(s) 245, 498
TaiI ACGT 1 cut(s) 356
TasI AATT 1 cut(s) 341
TfiI GAWTC 1 cut(s) 70
TscAI CASTG 1 cut(s) 268
TseI GCWGC 1 cut(s) 154
TspDTI ATGAA 1 cut(s) 459
TspRI CASTG 1 cut(s) 268
Van91I CCANNNNNTGG 1 cut(s) 374
VpaK11BI GGWCC 1 cut(s) 422
XapI RAATTY 1 cut(s) 341
XbaI TCTAGA 1 cut(s) 238
XspI CTAG 1 cut(s) 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.