Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002310.1

Orthogroup ID

OG0004636

Physical Location & Seq

Genomic Coordinates Forward (+)

31616 .. 38370

Gene Structure 6755 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002310.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1308 bp

atggagtccaggttattgggccacgaaattctcatggctactatgcttaatggggctgcaaatatagatggggcattgcttctgacgtctgagcatcttgctgctctgaaaattgtgccacttgttctgggatcaatatatgcaacatatatagcttcttcttcctcaattctagtagctgtaatatgctcaagtgatgatgatggagccgatcatgaactaagggttttgttgcggacgctgatacattctgctagggtaagtcctatagagaggcatagagagagagagatggcaaatcaaggtgcaaaaaagcgcaaggaagagaatgctcggcacatggcaaatatccgtctcctgattgtggcctgcaatgtgatgtatgtggtagtaaggatgctcatcttccattctacttttacctggaaaaactgggttgctttgctgctgacatctgtaatttattatattccctatcaacaactcgcccaaatggcaaatccttcttatgctgatgatggcgaacttctagatggcggatttgatatgaccactggtggagtgtgtggctatttacatgacgtaatctacattacaagcttcgtgcaagtcatgtccataatctctggaaaattttggtatacgtatctgctgataccaggttttggagcatacaaatcatttggtttcttcagaggatttatgtcccaaagttcagagggaggcttggaggatgaaaagacacgaaagaagagggaaaagatggaaaagaaggcttcaagagcccaattggctgcgttaacgcaagatctctcactttcactctcgtcggtgttgggcgatgttggaggggaattcgttgatggctgggttgctcaagatctgggctcagacacaatcgggggcttctgggatgtgatggattgctgggatcgagttggcgtgatgcattgtccaggtggttgttttggaccaggattggctttaggctggggaatggctacggacacggctgtgtttgttcgttttcatgttttggaggatgaagatgatggcgcggcggccttgacggtgagcgttggcggtgacgtggcaggtggcttttggctagaaagacacatgtgggctcaatgggttagggctttggtttaccctactctttgggcctgcatttggagtggctgggcttcttgggccttgcactggttggtgggcctcagctttgggctcactggcctagggtctcaagtgggctgtattacccttgtgctatggggctgggtttccatggccaatagcactgtttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF788

Protein Analysis

435

Amino Acids

47.81

Weight (kDa)

5.54

Isoelectric Point (pI)

36.04

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004636)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G23940 AT2G23940 AT2G23940 AT4G30500
fragaria_vesca	FvH4_3g25860
malus_domestica	MD00G1059200.v1.1 MD00G1091200.v1.1
prunus_persica	Prupe.1G100400_v2.0.a1 Prupe.1G100400_v2.0.a1 Prupe.1G100400_v2.0.a1 Prupe.1G100400_v2.0.a1
pyrus_communis	pycom13g28640
rosa_chinensis	RchiOBHm_Chr4g0405231 RchiOBHm_Chr5g0047191
rosa_laevigata	RLG00000008863 RLG00000034474
rosa_multiflora	Rmu_sc0002310.1_g000008 Rmu_sc0003154.1_g000026
rosa_roxburghii	Rroxscaffold_1G00034200 Rroxscaffold_5G00349550
rosa_rugosa	Rorug04G0055300 Rorug05G0234700
rosa_samantha	Rh4AG129800 Rh4BG124100 Rh4CG137100 Rh4DG123400 Rh5AG313500 Rh5BG322200 Rh5CG349300
rosa_wichuraiana	Rw4G010500 Rw5G029260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	1085
AatII	GACGTC	1 cut(s)	89
Acc36I	ACCTGC	1 cut(s)	1085
AccB7I	CCANNNNNTGG	1 cut(s)	665
AccI	GTMKAC	1 cut(s)	641
AccII	CGCG	1 cut(s)	1058
AciI	CCGC	5 cut(s)	235, 537, 1058, 1061, 1083
AclWI	GGATC	2 cut(s)	139, 939
AcoI	YGGCCR	1 cut(s)	1290
AcsI	RAATTY	3 cut(s)	27, 632, 854
AcuI	CTGAAG	1 cut(s)	676
AcyI	GRCGYC	1 cut(s)	86
AfiI	CCNNNNNNNGG	4 cut(s)	364, 665, 1173, 1203
AflIII	ACRYGT	1 cut(s)	1119
AgsI	TTSAA	1 cut(s)	780
AjiI	CACGTC	1 cut(s)	1090
AjnI	CCWGG	5 cut(s)	8, 422, 658, 955, 973
AleI	CACNNNNGTG	1 cut(s)	1013
AluBI	AGCT	4 cut(s)	155, 179, 600, 1221
AluI	AGCT	4 cut(s)	155, 179, 600, 1221
Alw26I	GTCTC	2 cut(s)	359, 1248
AlwI	GGATC	2 cut(s)	139, 939
AoxI	GGCC	8 cut(s)	19, 366, 1062, 1164, 1194, 1213, 1234, 1290
ApeKI	GCWGC	4 cut(s)	56, 101, 445, 794
ApoI	RAATTY	3 cut(s)	27, 632, 854
AspA2I	CCTAGG	1 cut(s)	1237
AspLEI	GCGC	2 cut(s)	318, 1058
AspS9I	GGNCC	5 cut(s)	19, 971, 1164, 1194, 1213
AsuHPI	GGTGA	2 cut(s)	1084, 1097
AvaII	GGWCC	1 cut(s)	971
AvrII	CCTAGG	1 cut(s)	1237
BalI	TGGCCA	1 cut(s)	1292
BanII	GRGCYC	4 cut(s)	787, 890, 1129, 1230
BbvCI	CCTCAGC	1 cut(s)	1217
BbvI	GCAGC	4 cut(s)	43, 88, 432, 781
BccI	CCATC	9 cut(s)	62, 197, 286, 512, 527, 757, 857, 913, 1046
BceAI	ACGGC	1 cut(s)	1026
BciT130I	CCWGG	5 cut(s)	10, 424, 660, 957, 975
BcoDI	GTCTC	2 cut(s)	359, 1248
BfaI	CTAG	5 cut(s)	173, 255, 530, 1109, 1238
BfmI	CTRYAG	1 cut(s)	267
BfuAI	ACCTGC	1 cut(s)	1085
BglI	GCCNNNNNGGC	2 cut(s)	494, 791
BglII	AGATCT	2 cut(s)	808, 880
BisI	GCNGC	6 cut(s)	57, 102, 446, 795, 1059, 1062
BlnI	CCTAGG	1 cut(s)	1237
BlsI	GCNGC	6 cut(s)	58, 103, 447, 796, 1060, 1063
Bme1390I	CCNGG	5 cut(s)	10, 424, 660, 957, 975
Bme18I	GGWCC	1 cut(s)	971
BmgBI	CACGTC	1 cut(s)	1090
BmgT120I	GGNCC	5 cut(s)	19, 971, 1164, 1194, 1213
BmiI	GGNNCC	1 cut(s)	208
BmrFI	CCNGG	5 cut(s)	10, 424, 660, 957, 975
BmrI	ACTGGG	1 cut(s)	442
BmsI	GCATC	3 cut(s)	103, 387, 936
BmuI	ACTGGG	1 cut(s)	442
Bpu10I	CCTNAGC	1 cut(s)	1217
BpuEI	CTTGAG	3 cut(s)	175, 861, 1230
BsaAI	YACGTR	1 cut(s)	645
BsaBI	GATNNNNATC	1 cut(s)	401
BsaHI	GRCGYC	1 cut(s)	86
BsaI	GGTCTC	1 cut(s)	1248
BsaJI	CCNNGG	2 cut(s)	1237, 1287
BsaXI	ACNNNNNCTCC	1 cut(s)	26
Bsc4I	CCNNNNNNNGG	4 cut(s)	364, 665, 1173, 1203
Bse1I	ACTGG	4 cut(s)	437, 559, 1208, 1237
Bse3DI	GCAATG	2 cut(s)	74, 379
Bse8I	GATNNNNATC	1 cut(s)	401
BseBI	CCWGG	5 cut(s)	10, 424, 660, 957, 975
BseDI	CCNNGG	2 cut(s)	1237, 1287
BseGI	GGATG	4 cut(s)	402, 739, 919, 1048
BseJI	GATNNNNATC	1 cut(s)	401
BseLI	CCNNNNNNNGG	4 cut(s)	364, 665, 1173, 1203
BseMI	GCAATG	2 cut(s)	74, 379
BseMII	CTCAG	3 cut(s)	81, 903, 1231
BseNI	ACTGG	4 cut(s)	437, 559, 1208, 1237
BseXI	GCAGC	4 cut(s)	43, 88, 432, 781
BseYI	CCCAGC	5 cut(s)	867, 927, 990, 1182, 1278
Bsh1236I	CGCG	1 cut(s)	1058
BshFI	GGCC	8 cut(s)	21, 368, 1064, 1166, 1196, 1215, 1236, 1292
BslFI	GGGAC	1 cut(s)	691
BslI	CCNNNNNNNGG	4 cut(s)	364, 665, 1173, 1203
BsmAI	GTCTC	2 cut(s)	359, 1248
BsmBI	CGTCTC	1 cut(s)	359
BsmFI	GGGAC	1 cut(s)	691
BsmI	GAATGC	1 cut(s)	334
BsnI	GGCC	8 cut(s)	21, 368, 1064, 1166, 1196, 1215, 1236, 1292
Bso31I	GGTCTC	1 cut(s)	1248
Bsp1286I	GDGCHC	4 cut(s)	787, 890, 1129, 1230
Bsp143I	GATC	5 cut(s)	131, 211, 808, 880, 931
Bsp19I	CCATGG	1 cut(s)	1287
BspACI	CCGC	5 cut(s)	235, 537, 1058, 1061, 1083
BspANI	GGCC	8 cut(s)	21, 368, 1064, 1166, 1196, 1215, 1236, 1292
BspCNI	CTCAG	3 cut(s)	82, 902, 1230
BspFNI	CGCG	1 cut(s)	1058
BspHI	TCATGA	1 cut(s)	214
BspLI	GGNNCC	1 cut(s)	208
BspMI	ACCTGC	1 cut(s)	1085
BspPI	GGATC	2 cut(s)	139, 939
BspTNI	GGTCTC	1 cut(s)	1248
BsrDI	GCAATG	2 cut(s)	74, 379
BsrI	ACTGG	4 cut(s)	437, 559, 1208, 1237
BssECI	CCNNGG	2 cut(s)	1237, 1287
BssMI	GATC	5 cut(s)	131, 211, 808, 880, 931
BssNAI	GTATAC	1 cut(s)	642
BssNI	GRCGYC	1 cut(s)	86
BssT1I	CCWWGG	2 cut(s)	1237, 1287
Bst1107I	GTATAC	1 cut(s)	642
Bst2UI	CCWGG	5 cut(s)	10, 424, 660, 957, 975
Bst4CI	ACNGT	2 cut(s)	1072, 1303
Bst6I	CTCTTC	2 cut(s)	318, 746
BstACI	GRCGYC	1 cut(s)	86
BstBAI	YACGTR	1 cut(s)	645
BstC8I	GCNNGC	2 cut(s)	370, 1168
BstDEI	CTNAG	4 cut(s)	90, 221, 889, 1217
BstDSI	CCRYGG	1 cut(s)	1287
BstF5I	GGATG	4 cut(s)	402, 739, 919, 1048
BstFNI	CGCG	1 cut(s)	1058
BstHHI	GCGC	2 cut(s)	318, 1058
BstKTI	GATC	5 cut(s)	134, 214, 811, 883, 934
BstMAI	GTCTC	2 cut(s)	359, 1248
BstMBI	GATC	5 cut(s)	131, 211, 808, 880, 931
BstMWI	GCNNNNNNNGC	4 cut(s)	494, 782, 791, 1193
BstNI	CCWGG	5 cut(s)	10, 424, 660, 957, 975
BstNSI	RCATGY	1 cut(s)	1123
BstSCI	CCNGG	5 cut(s)	8, 422, 658, 955, 973
BstSFI	CTRYAG	1 cut(s)	267
BstSNI	TACGTA	1 cut(s)	645
BstUI	CGCG	1 cut(s)	1058
BstV1I	GCAGC	4 cut(s)	43, 88, 432, 781
BstX2I	RGATCY	2 cut(s)	808, 880
BstXI	CCANNNNNNTGG	1 cut(s)	16
BstYI	RGATCY	2 cut(s)	808, 880
BstZ17I	GTATAC	1 cut(s)	642
BsuRI	GGCC	8 cut(s)	21, 368, 1064, 1166, 1196, 1215, 1236, 1292
BtgI	CCRYGG	1 cut(s)	1287
BtgZI	GCGATG	1 cut(s)	855
BtrI	CACGTC	1 cut(s)	1090
BtsCI	GGATG	4 cut(s)	402, 739, 919, 1048
BtsIMutI	CAGTG	4 cut(s)	552, 1201, 1230, 1299
BveI	ACCTGC	1 cut(s)	1085
Cac8I	GCNNGC	2 cut(s)	370, 1168
CciI	TCATGA	1 cut(s)	214
CfoI	GCGC	2 cut(s)	318, 1058
Cfr13I	GGNCC	5 cut(s)	19, 971, 1164, 1194, 1213
CseI	GACGC	1 cut(s)	247
CsiI	ACCWGGT	1 cut(s)	658
CviAII	CATG	8 cut(s)	34, 215, 340, 578, 613, 1031, 1120, 1288
DdeI	CTNAG	4 cut(s)	90, 221, 889, 1217
DpnI	GATC	5 cut(s)	133, 213, 810, 882, 933
DpnII	GATC	5 cut(s)	131, 211, 808, 880, 931
EaeI	YGGCCR	1 cut(s)	1290
Eam1104I	CTCTTC	2 cut(s)	318, 746
EarI	CTCTTC	2 cut(s)	318, 746
EciI	GGCGGA	1 cut(s)	552
Eco105I	TACGTA	1 cut(s)	645
Eco130I	CCWWGG	2 cut(s)	1237, 1287
Eco24I	GRGCYC	4 cut(s)	787, 890, 1129, 1230
Eco31I	GGTCTC	1 cut(s)	1248
Eco47I	GGWCC	1 cut(s)	971
Eco57I	CTGAAG	1 cut(s)	676
EcoRI	GAATTC	1 cut(s)	854
EcoRII	CCWGG	5 cut(s)	8, 422, 658, 955, 973
EcoT14I	CCWWGG	2 cut(s)	1237, 1287
EcoT22I	ATGCAT	1 cut(s)	951
EcoT38I	GRGCYC	4 cut(s)	787, 890, 1129, 1230
ErhI	CCWWGG	2 cut(s)	1237, 1287
Esp3I	CGTCTC	1 cut(s)	359
FaeI	CATG	8 cut(s)	37, 218, 343, 581, 616, 1034, 1123, 1291
FaqI	GGGAC	1 cut(s)	691
FatI	CATG	8 cut(s)	33, 214, 339, 577, 612, 1030, 1119, 1287
FblI	GTMKAC	1 cut(s)	641
Fnu4HI	GCNGC	6 cut(s)	57, 102, 446, 795, 1059, 1062
FokI	GGATG	4 cut(s)	409, 746, 926, 1055
FriOI	GRGCYC	4 cut(s)	787, 890, 1129, 1230
Fsp4HI	GCNGC	6 cut(s)	57, 102, 446, 795, 1059, 1062
FspBI	CTAG	5 cut(s)	173, 255, 530, 1109, 1238
GlaI	GCGC	2 cut(s)	317, 1057
GluI	GCNGC	6 cut(s)	57, 102, 446, 795, 1059, 1062
GsaI	CCCAGC	5 cut(s)	871, 931, 994, 1186, 1282
HaeIII	GGCC	8 cut(s)	21, 368, 1064, 1166, 1196, 1215, 1236, 1292
HgaI	GACGC	1 cut(s)	247
HhaI	GCGC	2 cut(s)	318, 1058
Hin1I	GRCGYC	1 cut(s)	86
Hin1II	CATG	8 cut(s)	37, 218, 343, 581, 616, 1034, 1123, 1291
Hin6I	GCGC	2 cut(s)	316, 1056
HinP1I	GCGC	2 cut(s)	316, 1056
HincII	GTYRAC	1 cut(s)	801
HindII	GTYRAC	1 cut(s)	801
HindIII	AAGCTT	1 cut(s)	598
HinfI	GANTC	1 cut(s)	5
HpaI	GTTAAC	1 cut(s)	801
HphI	GGTGA	2 cut(s)	1084, 1097
Hpy166II	GTNNAC	3 cut(s)	642, 801, 1150
Hpy188I	TCNGA	6 cut(s)	84, 91, 108, 695, 718, 892
Hpy188III	TCNNGA	6 cut(s)	215, 358, 530, 627, 780, 878
Hpy8I	GTNNAC	3 cut(s)	642, 801, 1150
Hpy99I	CGWCG	1 cut(s)	832
HpyAV	CCTTC	2 cut(s)	513, 766
HpyCH4III	ACNGT	2 cut(s)	1072, 1303
HpyCH4IV	ACGT	4 cut(s)	86, 582, 644, 1089
HpyCH4V	TGCA	8 cut(s)	59, 143, 308, 372, 607, 949, 1170, 1201
HpyF10VI	GCNNNNNNNGC	4 cut(s)	494, 782, 791, 1193
HpyF3I	CTNAG	4 cut(s)	90, 221, 889, 1217
HpySE526I	ACGT	4 cut(s)	86, 582, 644, 1089
Hsp92I	GRCGYC	1 cut(s)	86
Hsp92II	CATG	8 cut(s)	37, 218, 343, 581, 616, 1034, 1123, 1291
HspAI	GCGC	2 cut(s)	316, 1056
KspAI	GTTAAC	1 cut(s)	801
Kzo9I	GATC	5 cut(s)	131, 211, 808, 880, 931
LmnI	GCTCC	2 cut(s)	206, 668
Lsp1109I	GCAGC	4 cut(s)	43, 88, 432, 781
LweI	GCATC	3 cut(s)	103, 387, 936
MabI	ACCWGGT	1 cut(s)	658
MaeI	CTAG	5 cut(s)	173, 255, 530, 1109, 1238
MaeII	ACGT	4 cut(s)	86, 582, 644, 1089
MaeIII	GTNAC	1 cut(s)	1085
MalI	GATC	5 cut(s)	133, 213, 810, 882, 933
MboI	GATC	5 cut(s)	131, 211, 808, 880, 931
MboII	GAAGA	7 cut(s)	150, 153, 335, 397, 682, 763, 1058
MfeI	CAATTG	1 cut(s)	788
MflI	RGATCY	2 cut(s)	808, 880
MhlI	GDGCHC	4 cut(s)	787, 890, 1129, 1230
MlsI	TGGCCA	1 cut(s)	1292
MluCI	AATT	7 cut(s)	27, 111, 168, 459, 632, 788, 854
MluNI	TGGCCA	1 cut(s)	1292
MlyI	GAGTC	1 cut(s)	14
MmeI	TCCRAC	1 cut(s)	826
Mox20I	TGGCCA	1 cut(s)	1292
Mph1103I	ATGCAT	1 cut(s)	951
MscI	TGGCCA	1 cut(s)	1292
MseI	TTAA	3 cut(s)	48, 800, 1306
MslI	CAYNNNNRTG	1 cut(s)	1013
Msp20I	TGGCCA	1 cut(s)	1292
MspR9I	CCNGG	5 cut(s)	10, 424, 660, 957, 975
MunI	CAATTG	1 cut(s)	788
Mva1269I	GAATGC	1 cut(s)	334
MvaI	CCWGG	5 cut(s)	10, 424, 660, 957, 975
MvnI	CGCG	1 cut(s)	1058
MwoI	GCNNNNNNNGC	4 cut(s)	494, 782, 791, 1193
NcoI	CCATGG	1 cut(s)	1287
NdeII	GATC	5 cut(s)	131, 211, 808, 880, 931
NlaIII	CATG	8 cut(s)	37, 218, 343, 581, 616, 1034, 1123, 1291
NlaIV	GGNNCC	1 cut(s)	208
NmeAIII	GCCGAG	1 cut(s)	313
NmuCI	GTSAC	1 cut(s)	1085
NsiI	ATGCAT	1 cut(s)	951
NspI	RCATGY	1 cut(s)	1123
OliI	CACNNNNGTG	1 cut(s)	1013
PagI	TCATGA	1 cut(s)	214
PaqCI	CACCTGC	1 cut(s)	1085
PciI	ACATGT	1 cut(s)	1119
PctI	GAATGC	1 cut(s)	334
PflMI	CCANNNNNTGG	1 cut(s)	665
PkrI	GCNGC	6 cut(s)	58, 103, 447, 796, 1060, 1063
PleI	GAGTC	1 cut(s)	13
PpsI	GAGTC	1 cut(s)	13
Ppu21I	YACGTR	1 cut(s)	645
PscI	ACATGT	1 cut(s)	1119
Psp6I	CCWGG	5 cut(s)	8, 422, 658, 955, 973
PspFI	CCCAGC	5 cut(s)	867, 927, 990, 1182, 1278
PspGI	CCWGG	5 cut(s)	8, 422, 658, 955, 973
PspN4I	GGNNCC	1 cut(s)	208
PspPI	GGNCC	5 cut(s)	19, 971, 1164, 1194, 1213
PsuI	RGATCY	2 cut(s)	808, 880
RseI	CAYNNNNRTG	1 cut(s)	1013
SaqAI	TTAA	3 cut(s)	48, 800, 1306
SatI	GCNGC	6 cut(s)	57, 102, 446, 795, 1059, 1062
Sau3AI	GATC	5 cut(s)	131, 211, 808, 880, 931
Sau96I	GGNCC	5 cut(s)	19, 971, 1164, 1194, 1213
SchI	GAGTC	1 cut(s)	14
ScrFI	CCNGG	5 cut(s)	10, 424, 660, 957, 975
SduI	GDGCHC	4 cut(s)	787, 890, 1129, 1230
SexAI	ACCWGGT	1 cut(s)	658
SfaNI	GCATC	3 cut(s)	103, 387, 936
SfcI	CTRYAG	1 cut(s)	267
SinI	GGWCC	1 cut(s)	971
SmiMI	CAYNNNNRTG	1 cut(s)	1013
SmlI	CTYRAG	3 cut(s)	190, 876, 1245
SmoI	CTYRAG	3 cut(s)	190, 876, 1245
SnaBI	TACGTA	1 cut(s)	645
Sse9I	AATT	7 cut(s)	27, 111, 168, 459, 632, 788, 854
SsiI	CCGC	5 cut(s)	235, 537, 1058, 1061, 1083
SspMI	CTAG	5 cut(s)	173, 255, 530, 1109, 1238
StyD4I	CCNGG	5 cut(s)	8, 422, 658, 955, 973
StyI	CCWWGG	2 cut(s)	1237, 1287
TaaI	ACNGT	2 cut(s)	1072, 1303
TaiI	ACGT	4 cut(s)	89, 585, 647, 1092
TaqI	TCGA	1 cut(s)	934
TasI	AATT	7 cut(s)	27, 111, 168, 459, 632, 788, 854
TauI	GCSGC	2 cut(s)	1061, 1064
Tru1I	TTAA	3 cut(s)	48, 800, 1306
Tru9I	TTAA	3 cut(s)	48, 800, 1306
TscAI	CASTG	4 cut(s)	559, 1208, 1237, 1306
TseFI	GTSAC	1 cut(s)	1085
TseI	GCWGC	4 cut(s)	56, 101, 445, 794
Tsp45I	GTSAC	1 cut(s)	1085
TspDTI	ATGAA	4 cut(s)	231, 750, 1019, 1059
TspGWI	ACGGA	2 cut(s)	341, 1019
TspRI	CASTG	4 cut(s)	559, 1208, 1237, 1306
Van91I	CCANNNNNTGG	1 cut(s)	665
VpaK11BI	GGWCC	1 cut(s)	971
XapI	RAATTY	3 cut(s)	27, 632, 854
XbaI	TCTAGA	1 cut(s)	529
XceI	RCATGY	1 cut(s)	1123
XmaJI	CCTAGG	1 cut(s)	1237
XmiI	GTMKAC	1 cut(s)	641
XspI	CTAG	5 cut(s)	173, 255, 530, 1109, 1238
ZraI	GACGTC	1 cut(s)	87
Zsp2I	ATGCAT	1 cut(s)	951

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.