MD00G1091200.v1.1

Protein of unknown function (DUF788)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
OG0004636
Physical Location & Seq
Forward (+)
18972062 .. 18978229
6168 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1091200.v1.1.491

Sequence Viewer

Length: 522 bp
ATGGCAAATCAAGGTGCAAAGAAGCGCAAAGAAGAGAACGCCCGACACATGGCAAATCTCCGTCGCCTGATCATAGCCTGTAATGTTTTTTATGTGCTACTAAGGATGCTCATCTTCCATTCTAGTTTCGCCTGGAAAAATTGGGTTGCTTTGCTTCTCACTTCTCTTGCTTATTACTATCCCTATCAACAACTCGCTCAAATGGCAAATCCTTCTTATGGCGATGATGGGGAACTTCTGGATGGTGGCTTTGATACGACTACTGGTGGAGTATGTGGCTATTTGCATGATGTAATCTATATCACAGGCTTCGTGCAAGTCATGTCCATAATCTCTGGAAAATTTTGGTACACGTATCTGCTGATACCAGGTTTTGGAGCATACAAATCATTTGGTTTCATTAGAGGATTTATGTCTCAAGGTTCAGAGGGGGGTGTTGAGGATGAAAAGACTCGGAAGAAGAGGGAAAAGTTGGAGAAGAAGGCTTCAAGACCCCAGTTTGTCAAGACAAGAAACAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF788

Protein Analysis

174

Amino Acids

19.81

Weight (kDa)

9.64

Isoelectric Point (pI)

40.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TMEM208_SND2 PF05620 1 - 162 6.7e-55 SRP-independent targeting protein 2/TMEM208
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 374
AcsI RAATTY 1 cut(s) 341
AfaI GTAC 1 cut(s) 350
AfiI CCNNNNNNNGG 3 cut(s) 49, 218, 374
AflIII ACRYGT 1 cut(s) 351
AgsI TTSAA 1 cut(s) 489
AjnI CCWGG 2 cut(s) 131, 367
Alw26I GTCTC 1 cut(s) 420
ApoI RAATTY 1 cut(s) 341
AspLEI GCGC 1 cut(s) 27
BccI CCATC 2 cut(s) 221, 236
BciT130I CCWGG 2 cut(s) 133, 369
BclI TGATCA 1 cut(s) 69
BcoDI GTCTC 1 cut(s) 420
BfaI CTAG 1 cut(s) 123
Bme1390I CCNGG 2 cut(s) 133, 369
BmrFI CCNGG 2 cut(s) 133, 369
BmrI ACTGGG 1 cut(s) 490
BmsI GCATC 1 cut(s) 96
BmuI ACTGGG 1 cut(s) 490
BpuEI CTTGAG 1 cut(s) 402
BsaAI YACGTR 1 cut(s) 354
BsaBI GATNNNNATC 1 cut(s) 110
Bsc4I CCNNNNNNNGG 3 cut(s) 49, 218, 374
Bse1I ACTGG 2 cut(s) 268, 496
Bse8I GATNNNNATC 1 cut(s) 110
BseBI CCWGG 2 cut(s) 133, 369
BseGI GGATG 3 cut(s) 111, 247, 448
BseJI GATNNNNATC 1 cut(s) 110
BseLI CCNNNNNNNGG 3 cut(s) 49, 218, 374
BseNI ACTGG 2 cut(s) 268, 496
BslI CCNNNNNNNGG 3 cut(s) 49, 218, 374
BsmAI GTCTC 1 cut(s) 420
Bsp143I GATC 1 cut(s) 69
BsrI ACTGG 2 cut(s) 268, 496
BssMI GATC 1 cut(s) 69
Bst2UI CCWGG 2 cut(s) 133, 369
Bst6I CTCTTC 2 cut(s) 27, 455
BstBAI YACGTR 1 cut(s) 354
BstDEI CTNAG 1 cut(s) 101
BstF5I GGATG 3 cut(s) 111, 247, 448
BstHHI GCGC 1 cut(s) 27
BstKTI GATC 1 cut(s) 72
BstMAI GTCTC 1 cut(s) 420
BstMBI GATC 1 cut(s) 69
BstMWI GCNNNNNNNGC 1 cut(s) 203
BstNI CCWGG 2 cut(s) 133, 369
BstSCI CCNGG 2 cut(s) 131, 367
BtgZI GCGATG 1 cut(s) 237
BtsCI GGATG 3 cut(s) 111, 247, 448
CfoI GCGC 1 cut(s) 27
CsiI ACCWGGT 1 cut(s) 367
Csp6I GTAC 1 cut(s) 349
CviAII CATG 3 cut(s) 49, 287, 322
CviJI RGCY 5 cut(s) 77, 249, 279, 309, 485
CviKI_1 RGCY 5 cut(s) 77, 249, 279, 309, 485
CviQI GTAC 1 cut(s) 349
DdeI CTNAG 1 cut(s) 101
DpnI GATC 1 cut(s) 71
DpnII GATC 1 cut(s) 69
Eam1104I CTCTTC 2 cut(s) 27, 455
EarI CTCTTC 2 cut(s) 27, 455
EcoRII CCWGG 2 cut(s) 131, 367
FaeI CATG 3 cut(s) 52, 290, 325
FatI CATG 3 cut(s) 48, 286, 321
FbaI TGATCA 1 cut(s) 69
FokI GGATG 3 cut(s) 118, 254, 455
FspBI CTAG 1 cut(s) 123
GlaI GCGC 1 cut(s) 26
HhaI GCGC 1 cut(s) 27
Hin1II CATG 3 cut(s) 52, 290, 325
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HinfI GANTC 1 cut(s) 451
Hpy166II GTNNAC 1 cut(s) 351
Hpy188I TCNGA 2 cut(s) 427, 456
Hpy188III TCNNGA 4 cut(s) 239, 336, 489, 505
Hpy8I GTNNAC 1 cut(s) 351
Hpy99I CGWCG 1 cut(s) 66
HpyAV CCTTC 2 cut(s) 222, 475
HpyCH4IV ACGT 1 cut(s) 353
HpyCH4V TGCA 3 cut(s) 17, 286, 316
HpyF10VI GCNNNNNNNGC 1 cut(s) 203
HpyF3I CTNAG 1 cut(s) 101
HpySE526I ACGT 1 cut(s) 353
Hsp92II CATG 3 cut(s) 52, 290, 325
HspAI GCGC 1 cut(s) 25
Ksp22I TGATCA 1 cut(s) 69
Kzo9I GATC 1 cut(s) 69
LmnI GCTCC 1 cut(s) 377
LweI GCATC 1 cut(s) 96
MabI ACCWGGT 1 cut(s) 367
MaeI CTAG 1 cut(s) 123
MaeII ACGT 1 cut(s) 353
MalI GATC 1 cut(s) 71
MboI GATC 1 cut(s) 69
MboII GAAGA 5 cut(s) 44, 106, 469, 472, 490
MluCI AATT 2 cut(s) 139, 341
MlyI GAGTC 1 cut(s) 445
MmeI TCCRAC 1 cut(s) 453
MnlI CCTC 4 cut(s) 398, 421, 433, 456
MspR9I CCNGG 2 cut(s) 133, 369
MvaI CCWGG 2 cut(s) 133, 369
MwoI GCNNNNNNNGC 1 cut(s) 203
NdeII GATC 1 cut(s) 69
NlaIII CATG 3 cut(s) 52, 290, 325
PflMI CCANNNNNTGG 1 cut(s) 374
PleI GAGTC 1 cut(s) 445
PpsI GAGTC 1 cut(s) 445
Ppu21I YACGTR 1 cut(s) 354
Psp6I CCWGG 2 cut(s) 131, 367
PspGI CCWGG 2 cut(s) 131, 367
RsaI GTAC 1 cut(s) 350
RsaNI GTAC 1 cut(s) 349
Sau3AI GATC 1 cut(s) 69
SchI GAGTC 1 cut(s) 445
ScrFI CCNGG 2 cut(s) 133, 369
SetI ASST 4 cut(s) 16, 356, 373, 424
SexAI ACCWGGT 1 cut(s) 367
SfaNI GCATC 1 cut(s) 96
SmlI CTYRAG 1 cut(s) 417
SmoI CTYRAG 1 cut(s) 417
Sse9I AATT 2 cut(s) 139, 341
SspMI CTAG 1 cut(s) 123
StyD4I CCNGG 2 cut(s) 131, 367
TaiI ACGT 1 cut(s) 356
TasI AATT 2 cut(s) 139, 341
TspDTI ATGAA 2 cut(s) 388, 459
TspGWI ACGGA 1 cut(s) 50
Van91I CCANNNNNTGG 1 cut(s) 374
XapI RAATTY 1 cut(s) 341
XspI CTAG 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.