FvH4_3g46100

Alpha-ketoglutarate-dependent dioxygenase alkB homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0005744
Physical Location & Seq
Forward (+)
38252434 .. 38257906
5473 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g46100.t5

Sequence Viewer

Length: 600 bp
ATGGAAGGAAACCAGGCGCTAAATAATTTCAAAGTTGGATCTCTGCCCACTGTAATATACATTCCTGACTTCATTACGAAGAATGAAGAAACTCTACTTCTAAAAAATATTTATGATGCCCCTGTATCGAAGTGGAAATCTTTAAAAAATAGGAGGCTACAAAACTGGGGTGGTGTAGTCCATGAAAAGGGTCTGATATCACAGGATTTGCCCTCATGGTTAACAAAGATCACATGCAGGATTTTTGAAGAATCTGGGCTATTCCCATCACCAATTAACCATGTCCTTGTCAATGAATATCTTCCTAACCAAGGGATAATGGCACACCAAGATGGGCCAGCTTACTATCCAGTCGTAGCAATTCTGTCTCTTGGGTCACCAGTAGTTATGAATTTCACTCCCCATTCAAGATTGACATTGGGTGCAGGCACATGTTCACACAACTCTATGTATTCAAATTCTGATGGGAGACTTTCCCAGACTGATGCAAATAAATCGTTGCATGAACACCAACCATTTTCTGTCTTATTGATGCCATGCAGTTTGCTTATATTCAAAGATAAAGCATACTCAGAACATCTGAGCAGGTCCTGCCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy_2

Protein Analysis

200

Amino Acids

22.24

Weight (kDa)

7.73

Isoelectric Point (pI)

48.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
2OG-FeII_Oxy_2 PF13532 52 - 254 9.8e-12 2OG-Fe(II) oxygenase superfamily
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 576
AclWI GGATC 1 cut(s) 46
AcsI RAATTY 2 cut(s) 391, 457
AfiI CCNNNNNNNGG 2 cut(s) 187, 311
AflIII ACRYGT 1 cut(s) 431
AgsI TTSAA 5 cut(s) 31, 248, 408, 456, 556
AjnI CCWGG 1 cut(s) 12
AluBI AGCT 1 cut(s) 341
AluI AGCT 1 cut(s) 341
Alw26I GTCTC 2 cut(s) 372, 463
AlwI GGATC 1 cut(s) 46
AlwNI CAGNNNCTG 1 cut(s) 591
AoxI GGCC 1 cut(s) 335
ApoI RAATTY 2 cut(s) 391, 457
Asp700I GAANNNNTTC 1 cut(s) 300
AspLEI GCGC 1 cut(s) 19
AspS9I GGNCC 2 cut(s) 335, 588
AsuHPI GGTGA 2 cut(s) 261, 369
AvaII GGWCC 1 cut(s) 588
BarI GAAGNNNNNNTAC 2 cut(s) 78, 110
BccI CCATC 3 cut(s) 274, 326, 458
BcgI CGANNNNNNTGC 2 cut(s) 477, 511
BciT130I CCWGG 1 cut(s) 14
BcoDI GTCTC 2 cut(s) 372, 463
BfoI RGCGCY 1 cut(s) 20
BfuAI ACCTGC 1 cut(s) 576
Bme1390I CCNGG 1 cut(s) 14
Bme18I GGWCC 1 cut(s) 588
BmgT120I GGNCC 2 cut(s) 335, 588
BmrFI CCNGG 1 cut(s) 14
BmrI ACTGGG 1 cut(s) 175
BmsI GCATC 3 cut(s) 106, 475, 522
BmuI ACTGGG 1 cut(s) 175
BsaJI CCNNGG 1 cut(s) 310
Bsc4I CCNNNNNNNGG 2 cut(s) 187, 311
Bse1I ACTGG 3 cut(s) 170, 350, 380
BseBI CCWGG 1 cut(s) 14
BseDI CCNNGG 1 cut(s) 310
BseLI CCNNNNNNNGG 2 cut(s) 187, 311
BseMII CTCAG 2 cut(s) 572, 585
BseNI ACTGG 3 cut(s) 170, 350, 380
BsgI GTGCAG 1 cut(s) 444
BshFI GGCC 1 cut(s) 337
BslI CCNNNNNNNGG 2 cut(s) 187, 311
BsmAI GTCTC 2 cut(s) 372, 463
BsnI GGCC 1 cut(s) 337
Bsp143I GATC 2 cut(s) 38, 228
BspANI GGCC 1 cut(s) 337
BspCNI CTCAG 2 cut(s) 573, 584
BspMI ACCTGC 1 cut(s) 576
BspPI GGATC 1 cut(s) 46
BsrI ACTGG 3 cut(s) 170, 350, 380
BssECI CCNNGG 1 cut(s) 310
BssMI GATC 2 cut(s) 38, 228
BssT1I CCWWGG 1 cut(s) 310
Bst2UI CCWGG 1 cut(s) 14
Bst4CI ACNGT 1 cut(s) 52
BstAPI GCANNNNNTGC 1 cut(s) 591
BstC8I GCNNGC 2 cut(s) 339, 427
BstDEI CTNAG 2 cut(s) 571, 581
BstEII GGTNACC 1 cut(s) 375
BstENI CCTNNNNNAGG 1 cut(s) 309
BstH2I RGCGCY 1 cut(s) 20
BstHHI GCGC 1 cut(s) 19
BstKTI GATC 2 cut(s) 41, 231
BstMAI GTCTC 2 cut(s) 372, 463
BstMBI GATC 2 cut(s) 38, 228
BstMWI GCNNNNNNNGC 1 cut(s) 591
BstNI CCWGG 1 cut(s) 14
BstNSI RCATGY 2 cut(s) 237, 435
BstPI GGTNACC 1 cut(s) 375
BstSCI CCNGG 1 cut(s) 12
BstX2I RGATCY 1 cut(s) 38
BstYI RGATCY 1 cut(s) 38
BsuRI GGCC 1 cut(s) 337
BtsIMutI CAGTG 1 cut(s) 48
BveI ACCTGC 1 cut(s) 576
Cac8I GCNNGC 2 cut(s) 339, 427
CaiI CAGNNNCTG 1 cut(s) 591
CfoI GCGC 1 cut(s) 19
Cfr13I GGNCC 2 cut(s) 335, 588
CviAII CATG 7 cut(s) 182, 216, 234, 281, 432, 503, 537
CviJI RGCY 4 cut(s) 157, 259, 337, 341
CviKI_1 RGCY 4 cut(s) 157, 259, 337, 341
DdeI CTNAG 2 cut(s) 571, 581
DpnI GATC 2 cut(s) 40, 230
DpnII GATC 2 cut(s) 38, 228
DraI TTTAAA 1 cut(s) 144
Eco130I CCWWGG 1 cut(s) 310
Eco32I GATATC 1 cut(s) 198
Eco47I GGWCC 1 cut(s) 588
Eco91I GGTNACC 1 cut(s) 375
EcoNI CCTNNNNNAGG 1 cut(s) 309
EcoO109I RGGNCCY 1 cut(s) 588
EcoO65I GGTNACC 1 cut(s) 375
EcoRII CCWGG 1 cut(s) 12
EcoRV GATATC 1 cut(s) 198
EcoT14I CCWWGG 1 cut(s) 310
ErhI CCWWGG 1 cut(s) 310
FaeI CATG 7 cut(s) 185, 219, 237, 284, 435, 506, 540
FatI CATG 7 cut(s) 181, 215, 233, 280, 431, 502, 536
GlaI GCGC 1 cut(s) 18
HaeII RGCGCY 1 cut(s) 20
HaeIII GGCC 1 cut(s) 337
HhaI GCGC 1 cut(s) 19
Hin1II CATG 7 cut(s) 185, 219, 237, 284, 435, 506, 540
Hin6I GCGC 1 cut(s) 17
HinP1I GCGC 1 cut(s) 17
HincII GTYRAC 1 cut(s) 222
HindII GTYRAC 1 cut(s) 222
HinfI GANTC 1 cut(s) 251
HpaI GTTAAC 1 cut(s) 222
HphI GGTGA 2 cut(s) 261, 369
Hpy166II GTNNAC 2 cut(s) 222, 437
Hpy188I TCNGA 4 cut(s) 195, 463, 574, 582
Hpy188III TCNNGA 2 cut(s) 65, 408
Hpy8I GTNNAC 2 cut(s) 222, 437
HpyCH4III ACNGT 1 cut(s) 52
HpyCH4V TGCA 5 cut(s) 237, 425, 488, 502, 540
HpyF10VI GCNNNNNNNGC 1 cut(s) 591
HpyF3I CTNAG 2 cut(s) 571, 581
Hsp92II CATG 7 cut(s) 185, 219, 237, 284, 435, 506, 540
HspAI GCGC 1 cut(s) 17
KspAI GTTAAC 1 cut(s) 222
Kzo9I GATC 2 cut(s) 38, 228
LweI GCATC 3 cut(s) 106, 475, 522
MaeIII GTNAC 1 cut(s) 375
MalI GATC 2 cut(s) 40, 230
MboI GATC 2 cut(s) 38, 228
MboII GAAGA 4 cut(s) 91, 98, 260, 293
MflI RGATCY 1 cut(s) 38
MluCI AATT 5 cut(s) 25, 273, 360, 391, 457
MmeI TCCRAC 1 cut(s) 16
MnlI CCTC 2 cut(s) 147, 223
MroXI GAANNNNTTC 1 cut(s) 300
MseI TTAA 3 cut(s) 143, 221, 276
MslI CAYNNNNRTG 1 cut(s) 330
MspR9I CCNGG 1 cut(s) 14
MvaI CCWGG 1 cut(s) 14
MwoI GCNNNNNNNGC 1 cut(s) 591
NdeII GATC 2 cut(s) 38, 228
NlaIII CATG 7 cut(s) 185, 219, 237, 284, 435, 506, 540
NmuCI GTSAC 1 cut(s) 375
NspI RCATGY 2 cut(s) 237, 435
PciI ACATGT 1 cut(s) 431
PdmI GAANNNNTTC 1 cut(s) 300
PfeI GAWTC 1 cut(s) 251
PpuMI RGGWCCY 1 cut(s) 588
PscI ACATGT 1 cut(s) 431
Psp5II RGGWCCY 1 cut(s) 588
Psp6I CCWGG 1 cut(s) 12
PspEI GGTNACC 1 cut(s) 375
PspGI CCWGG 1 cut(s) 12
PspPI GGNCC 2 cut(s) 335, 588
PspPPI RGGWCCY 1 cut(s) 588
PstNI CAGNNNCTG 1 cut(s) 591
PsuI RGATCY 1 cut(s) 38
RseI CAYNNNNRTG 1 cut(s) 330
SaqAI TTAA 3 cut(s) 143, 221, 276
Sau3AI GATC 2 cut(s) 38, 228
Sau96I GGNCC 2 cut(s) 335, 588
ScrFI CCNGG 1 cut(s) 14
SetI ASST 2 cut(s) 343, 590
SfaNI GCATC 3 cut(s) 106, 475, 522
SinI GGWCC 1 cut(s) 588
SmiMI CAYNNNNRTG 1 cut(s) 330
Sse9I AATT 5 cut(s) 25, 273, 360, 391, 457
SspI AATATT 1 cut(s) 109
StyD4I CCNGG 1 cut(s) 12
StyI CCWWGG 1 cut(s) 310
TaaI ACNGT 1 cut(s) 52
TaqI TCGA 1 cut(s) 128
TasI AATT 5 cut(s) 25, 273, 360, 391, 457
TfiI GAWTC 1 cut(s) 251
Tru1I TTAA 3 cut(s) 143, 221, 276
Tru9I TTAA 3 cut(s) 143, 221, 276
TscAI CASTG 1 cut(s) 55
TseFI GTSAC 1 cut(s) 375
Tsp45I GTSAC 1 cut(s) 375
TspDTI ATGAA 6 cut(s) 61, 99, 198, 309, 404, 519
TspRI CASTG 1 cut(s) 55
VpaK11BI GGWCC 1 cut(s) 588
XagI CCTNNNNNAGG 1 cut(s) 309
XapI RAATTY 2 cut(s) 391, 457
XceI RCATGY 2 cut(s) 237, 435
XmnI GAANNNNTTC 1 cut(s) 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.