FvH4_5g10930

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Reverse (-)
6187325 .. 6189577
2253 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g10930.t1

Sequence Viewer

Length: 216 bp
ATGGCTCTGACAAATTTCATACTTACTGTGGCTGGTGTTAGTGCTGTGGTTCTTTTGTTGAGGAGTGATGTGAAACAGTCAGCTTCCATCTTCAGGCGGAACGTCAAGCATATCCGCAAGTGGCTTGAAGAAGAATCCAAGGCAGTCCCAAAGGAACTGGAAACTAAGGTTCCGCCAAAGGATATTCCCAAGGAGCCCAAGGAGGACAAACACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.09

Weight (kDa)

9.63

Isoelectric Point (pI)

68.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 97, 115, 173
AcsI RAATTY 1 cut(s) 13
AcuI CTGAAG 1 cut(s) 76
AfiI CCNNNNNNNGG 1 cut(s) 93
AgsI TTSAA 1 cut(s) 128
AluBI AGCT 1 cut(s) 83
AluI AGCT 1 cut(s) 83
ApoI RAATTY 1 cut(s) 13
BanII GRGCYC 1 cut(s) 198
BccI CCATC 1 cut(s) 95
BfaI CTAG 1 cut(s) 214
BmiI GGNNCC 2 cut(s) 171, 195
BsaJI CCNNGG 3 cut(s) 138, 189, 198
Bsc4I CCNNNNNNNGG 1 cut(s) 93
Bse1I ACTGG 1 cut(s) 162
BseDI CCNNGG 3 cut(s) 138, 189, 198
BseLI CCNNNNNNNGG 1 cut(s) 93
BseNI ACTGG 1 cut(s) 162
BseRI GAGGAG 1 cut(s) 76
BslFI GGGAC 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 93
BsmFI GGGAC 1 cut(s) 131
Bsp1286I GDGCHC 1 cut(s) 198
BspACI CCGC 3 cut(s) 97, 115, 173
BspLI GGNNCC 2 cut(s) 171, 195
BsrI ACTGG 1 cut(s) 162
BssECI CCNNGG 3 cut(s) 138, 189, 198
BssT1I CCWWGG 3 cut(s) 138, 189, 198
Bst4CI ACNGT 2 cut(s) 28, 78
BstDEI CTNAG 1 cut(s) 165
CviJI RGCY 5 cut(s) 5, 32, 83, 124, 196
CviKI_1 RGCY 5 cut(s) 5, 32, 83, 124, 196
DdeI CTNAG 1 cut(s) 165
EciI GGCGGA 2 cut(s) 112, 162
Eco130I CCWWGG 3 cut(s) 138, 189, 198
Eco24I GRGCYC 1 cut(s) 198
Eco57I CTGAAG 1 cut(s) 76
EcoT14I CCWWGG 3 cut(s) 138, 189, 198
EcoT38I GRGCYC 1 cut(s) 198
ErhI CCWWGG 3 cut(s) 138, 189, 198
FaiI YATR 2 cut(s) 20, 111
FaqI GGGAC 1 cut(s) 131
FriOI GRGCYC 1 cut(s) 198
FspBI CTAG 1 cut(s) 214
HinfI GANTC 1 cut(s) 134
Hpy188I TCNGA 1 cut(s) 9
HpyCH4III ACNGT 2 cut(s) 28, 78
HpyCH4IV ACGT 1 cut(s) 102
HpyF3I CTNAG 1 cut(s) 165
HpySE526I ACGT 1 cut(s) 102
LmnI GCTCC 1 cut(s) 193
LpnPI CCDG 3 cut(s) 18, 79, 143
MaeI CTAG 1 cut(s) 214
MaeII ACGT 1 cut(s) 102
MboII GAAGA 3 cut(s) 82, 140, 143
MhlI GDGCHC 1 cut(s) 198
MluCI AATT 1 cut(s) 13
MnlI CCTC 2 cut(s) 54, 196
NlaIV GGNNCC 2 cut(s) 171, 195
PfeI GAWTC 1 cut(s) 134
PspN4I GGNNCC 2 cut(s) 171, 195
SduI GDGCHC 1 cut(s) 198
SetI ASST 3 cut(s) 85, 105, 171
SgeI CNNG 9 cut(s) 45, 106, 118, 130, 137, 151, 170, 202, 211
Sse9I AATT 1 cut(s) 13
SsiI CCGC 3 cut(s) 97, 115, 173
SspMI CTAG 1 cut(s) 214
StyI CCWWGG 3 cut(s) 138, 189, 198
TaaI ACNGT 2 cut(s) 28, 78
TaiI ACGT 1 cut(s) 105
TasI AATT 1 cut(s) 13
TfiI GAWTC 1 cut(s) 134
TspDTI ATGAA 1 cut(s) 7
XapI RAATTY 1 cut(s) 13
XspI CTAG 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.