Rmu_sc0027221.1_g000005

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0027221.1
Physical Location & Seq
Reverse (-)
9557 .. 10219
663 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0027221.1_g000005.1.cds

Sequence Viewer

Length: 207 bp
atggctttgacaaacttcatactgacagtggcgggtgtgagtgctgtagttcttttattgaggagtgatgtgaaacagtcagctaccatatttaggcggaacgtcaaacatatccgaaagtggcttgaagaagaatccaaggcagtcccgaaggaacttgaaacaaaggttccgccgaaggatcttcgcaaggaggacaaacactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.81

Weight (kDa)

9.9

Isoelectric Point (pI)

71.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 32, 97, 173
AclWI GGATC 1 cut(s) 189
AfiI CCNNNNNNNGG 1 cut(s) 93
AgsI TTSAA 2 cut(s) 128, 161
AluBI AGCT 1 cut(s) 83
AluI AGCT 1 cut(s) 83
AlwI GGATC 1 cut(s) 189
BfaI CTAG 1 cut(s) 205
BfmI CTRYAG 1 cut(s) 45
BmiI GGNNCC 1 cut(s) 171
BsaJI CCNNGG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 1 cut(s) 93
BseDI CCNNGG 1 cut(s) 138
BseLI CCNNNNNNNGG 1 cut(s) 93
BseRI GAGGAG 1 cut(s) 76
BslFI GGGAC 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 93
BsmFI GGGAC 1 cut(s) 131
Bsp143I GATC 1 cut(s) 181
BspACI CCGC 3 cut(s) 32, 97, 173
BspLI GGNNCC 1 cut(s) 171
BspPI GGATC 1 cut(s) 189
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 1 cut(s) 181
BssT1I CCWWGG 1 cut(s) 138
Bst4CI ACNGT 2 cut(s) 28, 78
BstKTI GATC 1 cut(s) 184
BstMBI GATC 1 cut(s) 181
BstSFI CTRYAG 1 cut(s) 45
BstX2I RGATCY 1 cut(s) 181
BstYI RGATCY 1 cut(s) 181
BtsIMutI CAGTG 1 cut(s) 33
CviJI RGCY 3 cut(s) 5, 83, 124
CviKI_1 RGCY 3 cut(s) 5, 83, 124
DpnI GATC 1 cut(s) 183
DpnII GATC 1 cut(s) 181
EciI GGCGGA 2 cut(s) 112, 162
Eco130I CCWWGG 1 cut(s) 138
EcoT14I CCWWGG 1 cut(s) 138
ErhI CCWWGG 1 cut(s) 138
FaiI YATR 3 cut(s) 20, 89, 111
FaqI GGGAC 1 cut(s) 131
FauI CCCGC 1 cut(s) 25
FspBI CTAG 1 cut(s) 205
HinfI GANTC 1 cut(s) 134
Hpy188I TCNGA 1 cut(s) 116
Hpy188III TCNNGA 1 cut(s) 148
HpyAV CCTTC 2 cut(s) 145, 172
HpyCH4III ACNGT 2 cut(s) 28, 78
HpyCH4IV ACGT 1 cut(s) 102
HpySE526I ACGT 1 cut(s) 102
Kzo9I GATC 1 cut(s) 181
MaeI CTAG 1 cut(s) 205
MaeII ACGT 1 cut(s) 102
MalI GATC 1 cut(s) 183
MboI GATC 1 cut(s) 181
MboII GAAGA 3 cut(s) 140, 143, 176
MflI RGATCY 1 cut(s) 181
MnlI CCTC 2 cut(s) 54, 187
NdeII GATC 1 cut(s) 181
NlaIV GGNNCC 1 cut(s) 171
PfeI GAWTC 1 cut(s) 134
PspN4I GGNNCC 1 cut(s) 171
PsuI RGATCY 1 cut(s) 181
Sau3AI GATC 1 cut(s) 181
SetI ASST 3 cut(s) 85, 105, 171
SfcI CTRYAG 1 cut(s) 45
SgeI CNNG 6 cut(s) 45, 137, 151, 160, 170, 202
SsiI CCGC 3 cut(s) 32, 97, 173
SspMI CTAG 1 cut(s) 205
StyI CCWWGG 1 cut(s) 138
TaaI ACNGT 2 cut(s) 28, 78
TaiI ACGT 1 cut(s) 105
TfiI GAWTC 1 cut(s) 134
TscAI CASTG 1 cut(s) 33
TspDTI ATGAA 1 cut(s) 7
TspRI CASTG 1 cut(s) 33
XspI CTAG 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.