Rh1AG373400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
60679884 .. 60682988
3105 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG373400.1

Sequence Viewer

Length: 339 bp
ATGAATCTTCTCACTAATCAATCTAGAATTGTTCGTGAGGGTGTATTTTATTTTCATAATGTCAGCAGATTTAATTCAGTGAAGCAAAAAAATTTCTTCTTAGCTAGGTTTGGGAGAAGCACAAGAAATATGGCTTTGACAAACTTCATACTGACAGTGGCGGGTGTGAGTGCTGTAGTTCTTTTATTGAGGAGTGATGTGAAACAGTCAGCTACCATATTTAGGCGGAACGTCAAACATATCCGAAAGTGGCTTGAAGAAGAATCCAAGTATGTCCTTCAGTTTTTGTTTTATGAATTTTTTTCTCTTAACAAATTTGTTGATATATTTGCAAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

13.28

Weight (kDa)

10.74

Isoelectric Point (pI)

60.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 161, 226
AcsI RAATTY 3 cut(s) 91, 296, 314
AcuI CTGAAG 1 cut(s) 263
AfiI CCNNNNNNNGG 1 cut(s) 222
AgsI TTSAA 1 cut(s) 257
AluBI AGCT 2 cut(s) 104, 212
AluI AGCT 2 cut(s) 104, 212
ApoI RAATTY 3 cut(s) 91, 296, 314
BfaI CTAG 3 cut(s) 24, 105, 337
BfmI CTRYAG 1 cut(s) 174
Bsc4I CCNNNNNNNGG 1 cut(s) 222
BseLI CCNNNNNNNGG 1 cut(s) 222
BseRI GAGGAG 1 cut(s) 205
BslI CCNNNNNNNGG 1 cut(s) 222
BspACI CCGC 2 cut(s) 161, 226
Bst4CI ACNGT 2 cut(s) 157, 207
BstDEI CTNAG 1 cut(s) 100
BstSFI CTRYAG 1 cut(s) 174
BtsIMutI CAGTG 2 cut(s) 84, 162
CviJI RGCY 4 cut(s) 104, 134, 212, 253
CviKI_1 RGCY 4 cut(s) 104, 134, 212, 253
DdeI CTNAG 1 cut(s) 100
EciI GGCGGA 1 cut(s) 241
Eco57I CTGAAG 1 cut(s) 263
FaiI YATR 8 cut(s) 57, 131, 149, 218, 240, 273, 294, 326
FauI CCCGC 1 cut(s) 154
FspBI CTAG 3 cut(s) 24, 105, 337
HinfI GANTC 2 cut(s) 4, 263
Hpy188I TCNGA 1 cut(s) 245
Hpy188III TCNNGA 2 cut(s) 24, 35
HpyAV CCTTC 1 cut(s) 287
HpyCH4III ACNGT 2 cut(s) 157, 207
HpyCH4IV ACGT 1 cut(s) 231
HpyCH4V TGCA 1 cut(s) 332
HpyF3I CTNAG 1 cut(s) 100
HpySE526I ACGT 1 cut(s) 231
MaeI CTAG 3 cut(s) 24, 105, 337
MaeII ACGT 1 cut(s) 231
MboII GAAGA 3 cut(s) 88, 269, 272
MluCI AATT 5 cut(s) 27, 73, 91, 296, 314
MnlI CCTC 2 cut(s) 31, 183
MseI TTAA 2 cut(s) 72, 309
PfeI GAWTC 2 cut(s) 4, 263
SaqAI TTAA 2 cut(s) 72, 309
SetI ASST 4 cut(s) 106, 110, 214, 234
SfcI CTRYAG 1 cut(s) 174
SgeI CNNG 7 cut(s) 36, 47, 117, 135, 174, 266, 280
Sse9I AATT 5 cut(s) 27, 73, 91, 296, 314
SsiI CCGC 2 cut(s) 161, 226
SspMI CTAG 3 cut(s) 24, 105, 337
TaaI ACNGT 2 cut(s) 157, 207
TaiI ACGT 1 cut(s) 234
TasI AATT 5 cut(s) 27, 73, 91, 296, 314
TfiI GAWTC 2 cut(s) 4, 263
Tru1I TTAA 2 cut(s) 72, 309
Tru9I TTAA 2 cut(s) 72, 309
TscAI CASTG 2 cut(s) 84, 162
TspDTI ATGAA 4 cut(s) 17, 44, 136, 309
TspRI CASTG 2 cut(s) 84, 162
XapI RAATTY 3 cut(s) 91, 296, 314
XbaI TCTAGA 1 cut(s) 23
XspI CTAG 3 cut(s) 24, 105, 337
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.