Rw6G016370

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Forward (+)
32157304 .. 32158306
1003 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G016370.1

Sequence Viewer

Length: 240 bp
ATGGCTGTGACAAACTTCATACTGACAGTGGCTGGTGTAAGTACTGGTGTAAGTGCTGTAGTTCTTTTATTGAGGAGTGATGTGAAACAGTCAGCTACCATATTCAGGCGGAACGTCAAACATATCCGCAAGTGGCTTGAAGAAGAATCCAAGTATGCCCTTCAGTTTTTGTTTTATGAATTATTTTCTCTTAACAAATTTGTTCCGCTGAAGGATGTTCCCAAGGAGGACAAACATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

9.11

Weight (kDa)

9.63

Isoelectric Point (pI)

67.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 109, 127, 206
AcsI RAATTY 1 cut(s) 197
AcuI CTGAAG 2 cut(s) 146, 230
AfaI GTAC 1 cut(s) 43
AfiI CCNNNNNNNGG 1 cut(s) 105
AgsI TTSAA 1 cut(s) 140
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
AlwNI CAGNNNCTG 1 cut(s) 32
ApoI RAATTY 1 cut(s) 197
BfmI CTRYAG 1 cut(s) 57
BmcAI AGTACT 1 cut(s) 43
BsaJI CCNNGG 1 cut(s) 222
Bsc4I CCNNNNNNNGG 1 cut(s) 105
Bse1I ACTGG 1 cut(s) 49
BseDI CCNNGG 1 cut(s) 222
BseGI GGATG 1 cut(s) 220
BseLI CCNNNNNNNGG 1 cut(s) 105
BseNI ACTGG 1 cut(s) 49
BseRI GAGGAG 1 cut(s) 88
BslI CCNNNNNNNGG 1 cut(s) 105
BspACI CCGC 3 cut(s) 109, 127, 206
BsrI ACTGG 1 cut(s) 49
BssECI CCNNGG 1 cut(s) 222
BssT1I CCWWGG 1 cut(s) 222
Bst4CI ACNGT 2 cut(s) 28, 90
BstF5I GGATG 1 cut(s) 220
BstSFI CTRYAG 1 cut(s) 57
BtsCI GGATG 1 cut(s) 220
BtsIMutI CAGTG 1 cut(s) 33
CaiI CAGNNNCTG 1 cut(s) 32
Csp6I GTAC 1 cut(s) 42
CviJI RGCY 4 cut(s) 5, 32, 95, 136
CviKI_1 RGCY 4 cut(s) 5, 32, 95, 136
CviQI GTAC 1 cut(s) 42
EciI GGCGGA 1 cut(s) 124
Eco130I CCWWGG 1 cut(s) 222
Eco57I CTGAAG 2 cut(s) 146, 230
EcoT14I CCWWGG 1 cut(s) 222
ErhI CCWWGG 1 cut(s) 222
FaiI YATR 5 cut(s) 20, 101, 123, 156, 177
FokI GGATG 1 cut(s) 227
HinfI GANTC 1 cut(s) 146
HpyAV CCTTC 2 cut(s) 170, 205
HpyCH4III ACNGT 2 cut(s) 28, 90
HpyCH4IV ACGT 1 cut(s) 114
HpySE526I ACGT 1 cut(s) 114
LpnPI CCDG 3 cut(s) 18, 30, 91
MaeII ACGT 1 cut(s) 114
MaeIII GTNAC 1 cut(s) 7
MboII GAAGA 2 cut(s) 152, 155
MluCI AATT 2 cut(s) 179, 197
MnlI CCTC 2 cut(s) 66, 220
MseI TTAA 1 cut(s) 192
MspA1I CMGCKG 1 cut(s) 208
NmuCI GTSAC 1 cut(s) 7
PfeI GAWTC 1 cut(s) 146
PstNI CAGNNNCTG 1 cut(s) 32
RsaI GTAC 1 cut(s) 43
RsaNI GTAC 1 cut(s) 42
SaqAI TTAA 1 cut(s) 192
ScaI AGTACT 1 cut(s) 43
SetI ASST 2 cut(s) 97, 117
SfcI CTRYAG 1 cut(s) 57
SgeI CNNG 7 cut(s) 45, 57, 118, 142, 149, 163, 235
Sse9I AATT 2 cut(s) 179, 197
SsiI CCGC 3 cut(s) 109, 127, 206
StyI CCWWGG 1 cut(s) 222
TaaI ACNGT 2 cut(s) 28, 90
TaiI ACGT 1 cut(s) 117
TasI AATT 2 cut(s) 179, 197
TatI WGTACW 1 cut(s) 41
TfiI GAWTC 1 cut(s) 146
Tru1I TTAA 1 cut(s) 192
Tru9I TTAA 1 cut(s) 192
TscAI CASTG 1 cut(s) 33
TseFI GTSAC 1 cut(s) 7
Tsp45I GTSAC 1 cut(s) 7
TspDTI ATGAA 2 cut(s) 7, 192
TspRI CASTG 1 cut(s) 33
XapI RAATTY 1 cut(s) 197
ZrmI AGTACT 1 cut(s) 43
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.