Prupe.2G009500_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
877242 .. 877575
334 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G009500.1

Sequence Viewer

Length: 207 bp
ATGGCTTTGACAAACTTCATCCTGACTGTCGCTGGTGTAAGTGCGGTGGTTCTTCTGCTGAGGAGTGATGTGAAGCAATCGGCTACCATCTTCAGGCGCAATGTCAAACTTGGACATGGATTATTGCCAAAGATACCACCTAAAATCACCAAGGAACTGGAATCAAAAGTTTCACCAAAGGAGATCCCCAAGGAGGACAAGCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.5

Weight (kDa)

10.09

Isoelectric Point (pI)

50.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 44
AclWI GGATC 1 cut(s) 178
AcuI CTGAAG 1 cut(s) 76
AfiI CCNNNNNNNGG 2 cut(s) 93, 193
AlwI GGATC 1 cut(s) 178
AspLEI GCGC 1 cut(s) 99
AsuHPI GGTGA 2 cut(s) 139, 165
BbvCI CCTCAGC 1 cut(s) 59
BccI CCATC 1 cut(s) 95
BfaI CTAG 1 cut(s) 205
Bpu10I CCTNAGC 1 cut(s) 59
BsaJI CCNNGG 2 cut(s) 150, 189
Bsc4I CCNNNNNNNGG 2 cut(s) 93, 193
Bse1I ACTGG 1 cut(s) 162
Bse3DI GCAATG 1 cut(s) 106
BseDI CCNNGG 2 cut(s) 150, 189
BseGI GGATG 1 cut(s) 18
BseLI CCNNNNNNNGG 2 cut(s) 93, 193
BseMI GCAATG 1 cut(s) 106
BseMII CTCAG 1 cut(s) 50
BseNI ACTGG 1 cut(s) 162
BseRI GAGGAG 1 cut(s) 76
BslI CCNNNNNNNGG 2 cut(s) 93, 193
Bsp143I GATC 1 cut(s) 183
BspACI CCGC 1 cut(s) 44
BspCNI CTCAG 1 cut(s) 51
BspPI GGATC 1 cut(s) 178
BsrDI GCAATG 1 cut(s) 106
BsrI ACTGG 1 cut(s) 162
BssECI CCNNGG 2 cut(s) 150, 189
BssMI GATC 1 cut(s) 183
BssT1I CCWWGG 2 cut(s) 150, 189
Bst4CI ACNGT 1 cut(s) 28
BstDEI CTNAG 1 cut(s) 59
BstF5I GGATG 1 cut(s) 18
BstHHI GCGC 1 cut(s) 99
BstKTI GATC 1 cut(s) 186
BstMBI GATC 1 cut(s) 183
BstX2I RGATCY 1 cut(s) 183
BstXI CCANNNNNNTGG 1 cut(s) 157
BstYI RGATCY 1 cut(s) 183
BtsCI GGATG 1 cut(s) 18
CfoI GCGC 1 cut(s) 99
CviAII CATG 1 cut(s) 116
CviJI RGCY 2 cut(s) 5, 83
CviKI_1 RGCY 2 cut(s) 5, 83
DdeI CTNAG 1 cut(s) 59
DpnI GATC 1 cut(s) 185
DpnII GATC 1 cut(s) 183
Eco130I CCWWGG 2 cut(s) 150, 189
Eco57I CTGAAG 1 cut(s) 76
EcoT14I CCWWGG 2 cut(s) 150, 189
ErhI CCWWGG 2 cut(s) 150, 189
FaeI CATG 1 cut(s) 119
FaiI YATR 1 cut(s) 117
FatI CATG 1 cut(s) 115
FokI GGATG 1 cut(s) 5
FspBI CTAG 1 cut(s) 205
GlaI GCGC 1 cut(s) 98
HhaI GCGC 1 cut(s) 99
Hin1II CATG 1 cut(s) 119
Hin6I GCGC 1 cut(s) 97
HinP1I GCGC 1 cut(s) 97
HinfI GANTC 1 cut(s) 161
HphI GGTGA 2 cut(s) 139, 165
Hpy188III TCNNGA 1 cut(s) 22
HpyCH4III ACNGT 1 cut(s) 28
HpyF3I CTNAG 1 cut(s) 59
Hsp92II CATG 1 cut(s) 119
HspAI GCGC 1 cut(s) 97
Kzo9I GATC 1 cut(s) 183
LpnPI CCDG 4 cut(s) 18, 35, 79, 143
MaeI CTAG 1 cut(s) 205
MalI GATC 1 cut(s) 185
MboI GATC 1 cut(s) 183
MboII GAAGA 2 cut(s) 44, 82
MflI RGATCY 1 cut(s) 183
MnlI CCTC 2 cut(s) 54, 187
NdeII GATC 1 cut(s) 183
NlaIII CATG 1 cut(s) 119
PfeI GAWTC 1 cut(s) 161
PsuI RGATCY 1 cut(s) 183
Sau3AI GATC 1 cut(s) 183
SetI ASST 1 cut(s) 142
SgeI CNNG 8 cut(s) 34, 45, 106, 122, 128, 163, 170, 202
SsiI CCGC 1 cut(s) 44
SspMI CTAG 1 cut(s) 205
StyI CCWWGG 2 cut(s) 150, 189
TaaI ACNGT 1 cut(s) 28
TfiI GAWTC 1 cut(s) 161
TspDTI ATGAA 1 cut(s) 7
XspI CTAG 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.