Rh7DG085400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
6821458 .. 6823667
2210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG085400.1

Sequence Viewer

Length: 387 bp
ATGGATGTCATGGCCCAGCCCAACCTCACTGGATCCGAAAACGCATTTCGCCTGATTTTCTTGCTCCGAAAGCCACCACCACTCTTTACCGCCACCCACCTCTCTCAGCTACTCAACAACTCCCGGTTCACCGATTCTCAGTCAAAATTTCTCATCAGGTTTGGGAGAAGCACAAGAAACATGGCTTTGACAAACTTCATACTGACAGTGGCTGGTGTAAGTGCTGTAGTTCTTTTATTGAGGAGTGATGTGAAACAGTCAGCTACCATCTTCAGGCGGAACGTCAAACATATCCGCAAGTGGCTTGAAGAAGAATCCAAGGCAGTCCCAAAGGAACTGGAAACAAAGGTTCCGCCAAAGGATGTTCCCAAGGAGGACAAGCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

128

Amino Acids

14.61

Weight (kDa)

10.38

Isoelectric Point (pI)

63.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 90, 277, 295, 353
AclWI GGATC 2 cut(s) 27, 40
AcsI RAATTY 1 cut(s) 146
AcuI CTGAAG 1 cut(s) 256
AfiI CCNNNNNNNGG 1 cut(s) 273
AgsI TTSAA 1 cut(s) 308
AluBI AGCT 2 cut(s) 109, 263
AluI AGCT 2 cut(s) 109, 263
AlwI GGATC 2 cut(s) 27, 40
AlwNI CAGNNNCTG 1 cut(s) 212
AoxI GGCC 1 cut(s) 12
ApoI RAATTY 1 cut(s) 146
AspS9I GGNCC 1 cut(s) 13
AsuC2I CCSGG 1 cut(s) 124
AsuHPI GGTGA 1 cut(s) 121
BamHI GGATCC 1 cut(s) 32
BccI CCATC 1 cut(s) 275
BcnI CCSGG 1 cut(s) 124
BfaI CTAG 1 cut(s) 385
BfmI CTRYAG 1 cut(s) 225
Bme1390I CCNGG 1 cut(s) 124
BmgT120I GGNCC 1 cut(s) 13
BmiI GGNNCC 2 cut(s) 34, 351
BmrFI CCNGG 1 cut(s) 124
BpuMI CCSGG 1 cut(s) 124
BsaJI CCNNGG 2 cut(s) 318, 369
Bsc4I CCNNNNNNNGG 1 cut(s) 273
Bse1I ACTGG 2 cut(s) 34, 342
BseDI CCNNGG 2 cut(s) 318, 369
BseGI GGATG 2 cut(s) 10, 367
BseLI CCNNNNNNNGG 1 cut(s) 273
BseMII CTCAG 2 cut(s) 119, 152
BseNI ACTGG 2 cut(s) 34, 342
BseRI GAGGAG 1 cut(s) 256
BseYI CCCAGC 1 cut(s) 15
BshFI GGCC 1 cut(s) 14
BsiSI CCGG 1 cut(s) 124
BslFI GGGAC 1 cut(s) 311
BslI CCNNNNNNNGG 1 cut(s) 273
BsmFI GGGAC 1 cut(s) 311
BsnI GGCC 1 cut(s) 14
Bsp143I GATC 1 cut(s) 32
BspACI CCGC 4 cut(s) 90, 277, 295, 353
BspANI GGCC 1 cut(s) 14
BspCNI CTCAG 2 cut(s) 118, 151
BspLI GGNNCC 2 cut(s) 34, 351
BspPI GGATC 2 cut(s) 27, 40
BsrI ACTGG 2 cut(s) 34, 342
BssECI CCNNGG 2 cut(s) 318, 369
BssMI GATC 1 cut(s) 32
BssT1I CCWWGG 2 cut(s) 318, 369
Bst4CI ACNGT 2 cut(s) 208, 258
BstDEI CTNAG 2 cut(s) 105, 138
BstF5I GGATG 2 cut(s) 10, 367
BstKTI GATC 1 cut(s) 35
BstMBI GATC 1 cut(s) 32
BstMWI GCNNNNNNNGC 1 cut(s) 70
BstSCI CCNGG 1 cut(s) 122
BstSFI CTRYAG 1 cut(s) 225
BstX2I RGATCY 1 cut(s) 32
BstYI RGATCY 1 cut(s) 32
BsuRI GGCC 1 cut(s) 14
BtsCI GGATG 2 cut(s) 10, 367
BtsIMutI CAGTG 2 cut(s) 27, 213
CaiI CAGNNNCTG 1 cut(s) 212
Cfr13I GGNCC 1 cut(s) 13
CviAII CATG 2 cut(s) 10, 181
CviJI RGCY 8 cut(s) 14, 19, 73, 109, 185, 212, 263, 304
CviKI_1 RGCY 8 cut(s) 14, 19, 73, 109, 185, 212, 263, 304
DdeI CTNAG 2 cut(s) 105, 138
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
EciI GGCGGA 2 cut(s) 292, 342
Eco130I CCWWGG 2 cut(s) 318, 369
Eco57I CTGAAG 1 cut(s) 256
EcoT14I CCWWGG 2 cut(s) 318, 369
ErhI CCWWGG 2 cut(s) 318, 369
FaeI CATG 2 cut(s) 13, 184
FaiI YATR 4 cut(s) 11, 182, 200, 291
FaqI GGGAC 1 cut(s) 311
FatI CATG 2 cut(s) 9, 180
FokI GGATG 2 cut(s) 17, 374
FspBI CTAG 1 cut(s) 385
GsaI CCCAGC 1 cut(s) 19
HaeIII GGCC 1 cut(s) 14
HapII CCGG 1 cut(s) 124
Hin1II CATG 2 cut(s) 13, 184
HinfI GANTC 2 cut(s) 134, 314
HpaII CCGG 1 cut(s) 124
HphI GGTGA 1 cut(s) 121
Hpy166II GTNNAC 1 cut(s) 129
Hpy188I TCNGA 2 cut(s) 37, 68
Hpy8I GTNNAC 1 cut(s) 129
HpyCH4III ACNGT 2 cut(s) 208, 258
HpyCH4IV ACGT 1 cut(s) 282
HpyF10VI GCNNNNNNNGC 1 cut(s) 70
HpyF3I CTNAG 2 cut(s) 105, 138
HpySE526I ACGT 1 cut(s) 282
Hsp92II CATG 2 cut(s) 13, 184
Kzo9I GATC 1 cut(s) 32
LmnI GCTCC 1 cut(s) 69
LpnPI CCDG 8 cut(s) 15, 29, 65, 137, 142, 198, 259, 323
MaeI CTAG 1 cut(s) 385
MaeII ACGT 1 cut(s) 282
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MboII GAAGA 3 cut(s) 262, 320, 323
MflI RGATCY 1 cut(s) 32
MluCI AATT 1 cut(s) 146
MnlI CCTC 4 cut(s) 35, 110, 234, 367
MspI CCGG 1 cut(s) 124
MspR9I CCNGG 1 cut(s) 124
MwoI GCNNNNNNNGC 1 cut(s) 70
NciI CCSGG 1 cut(s) 124
NdeII GATC 1 cut(s) 32
NlaIII CATG 2 cut(s) 13, 184
NlaIV GGNNCC 2 cut(s) 34, 351
PfeI GAWTC 2 cut(s) 134, 314
PspFI CCCAGC 1 cut(s) 15
PspN4I GGNNCC 2 cut(s) 34, 351
PspPI GGNCC 1 cut(s) 13
PstNI CAGNNNCTG 1 cut(s) 212
PsuI RGATCY 1 cut(s) 32
Sau3AI GATC 1 cut(s) 32
Sau96I GGNCC 1 cut(s) 13
ScrFI CCNGG 1 cut(s) 124
SetI ASST 7 cut(s) 27, 102, 111, 161, 265, 285, 351
SfcI CTRYAG 1 cut(s) 225
Sse9I AATT 1 cut(s) 146
SsiI CCGC 4 cut(s) 90, 277, 295, 353
SspMI CTAG 1 cut(s) 385
StyD4I CCNGG 1 cut(s) 122
StyI CCWWGG 2 cut(s) 318, 369
TaaI ACNGT 2 cut(s) 208, 258
TaiI ACGT 1 cut(s) 285
TasI AATT 1 cut(s) 146
TfiI GAWTC 2 cut(s) 134, 314
TscAI CASTG 2 cut(s) 34, 213
TspDTI ATGAA 1 cut(s) 187
TspRI CASTG 2 cut(s) 34, 213
XapI RAATTY 1 cut(s) 146
XspI CTAG 1 cut(s) 385
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.