Prupe.5G129500_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
Physical Location & Seq
Forward (+)
12536069 .. 12537115
1047 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G129500.1

Sequence Viewer

Length: 216 bp
ATGGCTTTGACAAACTTCATACTGACTGTTGCTGGTGTAAGTGCGGTGGTTCTTCTGCTGAGGAGTGATGTGAAGCAATCAGCTACCATCTTCAGGCGCAATGTCAAACATATCCGTAAGTGGCTTGAAGAAGAATCTGCTAATGCCCCCAAAATCACCAAGGAACTGGAATCAAAAGCTTCACCAAAGGAGATCCCCAAGGAGGACAAGCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.01

Weight (kDa)

9.7

Isoelectric Point (pI)

71.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 44
AclWI GGATC 1 cut(s) 187
AcuI CTGAAG 1 cut(s) 76
AfiI CCNNNNNNNGG 2 cut(s) 93, 202
AgsI TTSAA 1 cut(s) 128
AluBI AGCT 2 cut(s) 83, 179
AluI AGCT 2 cut(s) 83, 179
AlwI GGATC 1 cut(s) 187
AspLEI GCGC 1 cut(s) 99
AsuHPI GGTGA 2 cut(s) 148, 174
BbvCI CCTCAGC 1 cut(s) 59
BccI CCATC 1 cut(s) 95
BfaI CTAG 1 cut(s) 214
Bpu10I CCTNAGC 1 cut(s) 59
BsaJI CCNNGG 2 cut(s) 159, 198
Bsc4I CCNNNNNNNGG 2 cut(s) 93, 202
Bse1I ACTGG 1 cut(s) 171
Bse3DI GCAATG 1 cut(s) 106
BseDI CCNNGG 2 cut(s) 159, 198
BseLI CCNNNNNNNGG 2 cut(s) 93, 202
BseMI GCAATG 1 cut(s) 106
BseMII CTCAG 1 cut(s) 50
BseNI ACTGG 1 cut(s) 171
BseRI GAGGAG 1 cut(s) 76
BslI CCNNNNNNNGG 2 cut(s) 93, 202
Bsp143I GATC 1 cut(s) 192
BspACI CCGC 1 cut(s) 44
BspCNI CTCAG 1 cut(s) 51
BspPI GGATC 1 cut(s) 187
BsrDI GCAATG 1 cut(s) 106
BsrI ACTGG 1 cut(s) 171
BssECI CCNNGG 2 cut(s) 159, 198
BssMI GATC 1 cut(s) 192
BssT1I CCWWGG 2 cut(s) 159, 198
Bst4CI ACNGT 1 cut(s) 28
BstDEI CTNAG 1 cut(s) 59
BstHHI GCGC 1 cut(s) 99
BstKTI GATC 1 cut(s) 195
BstMBI GATC 1 cut(s) 192
BstX2I RGATCY 1 cut(s) 192
BstXI CCANNNNNNTGG 1 cut(s) 166
BstYI RGATCY 1 cut(s) 192
CfoI GCGC 1 cut(s) 99
CviJI RGCY 4 cut(s) 5, 83, 124, 179
CviKI_1 RGCY 4 cut(s) 5, 83, 124, 179
DdeI CTNAG 1 cut(s) 59
DpnI GATC 1 cut(s) 194
DpnII GATC 1 cut(s) 192
Eco130I CCWWGG 2 cut(s) 159, 198
Eco57I CTGAAG 1 cut(s) 76
EcoT14I CCWWGG 2 cut(s) 159, 198
ErhI CCWWGG 2 cut(s) 159, 198
FaiI YATR 2 cut(s) 20, 111
FspBI CTAG 1 cut(s) 214
GlaI GCGC 1 cut(s) 98
HhaI GCGC 1 cut(s) 99
Hin6I GCGC 1 cut(s) 97
HinP1I GCGC 1 cut(s) 97
HindIII AAGCTT 1 cut(s) 177
HinfI GANTC 2 cut(s) 134, 170
HphI GGTGA 2 cut(s) 148, 174
HpyCH4III ACNGT 1 cut(s) 28
HpyF3I CTNAG 1 cut(s) 59
HspAI GCGC 1 cut(s) 97
Kzo9I GATC 1 cut(s) 192
LpnPI CCDG 3 cut(s) 18, 79, 152
MaeI CTAG 1 cut(s) 214
MalI GATC 1 cut(s) 194
MboI GATC 1 cut(s) 192
MboII GAAGA 4 cut(s) 44, 82, 140, 143
MflI RGATCY 1 cut(s) 192
MnlI CCTC 2 cut(s) 54, 196
NdeII GATC 1 cut(s) 192
PfeI GAWTC 2 cut(s) 134, 170
PsuI RGATCY 1 cut(s) 192
Sau3AI GATC 1 cut(s) 192
SetI ASST 2 cut(s) 85, 181
SgeI CNNG 6 cut(s) 45, 106, 137, 172, 179, 211
SsiI CCGC 1 cut(s) 44
SspMI CTAG 1 cut(s) 214
StyI CCWWGG 2 cut(s) 159, 198
TaaI ACNGT 1 cut(s) 28
TfiI GAWTC 2 cut(s) 134, 170
TspDTI ATGAA 1 cut(s) 7
TspGWI ACGGA 1 cut(s) 104
XspI CTAG 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.