Rw7G007350

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Forward (+)
6342763 .. 6343761
999 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G007350.1

Sequence Viewer

Length: 207 bp
ATGGCTTTGACAAACTTCATACTGACAGTGGCTGGTGTAAGTGCTGTAGTTCTTTTATTGAGGAGTGATGTGAAACAGTCAGCTACCATCTTCAGGCGGAACGTCAAACATATCCGCAAGTGGCTTGAAGAAGAATCCAAGGCAGTCCCAAAGGAACTGGAAACAAAGGTTCCGCCAAAGGATGTTCCCAAGGAGGACAAGCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.74

Weight (kDa)

9.7

Isoelectric Point (pI)

71.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 97, 115, 173
AcuI CTGAAG 1 cut(s) 76
AfiI CCNNNNNNNGG 1 cut(s) 93
AgsI TTSAA 1 cut(s) 128
AluBI AGCT 1 cut(s) 83
AluI AGCT 1 cut(s) 83
AlwNI CAGNNNCTG 1 cut(s) 32
BccI CCATC 1 cut(s) 95
BfaI CTAG 1 cut(s) 205
BfmI CTRYAG 1 cut(s) 45
BmiI GGNNCC 1 cut(s) 171
BsaJI CCNNGG 2 cut(s) 138, 189
Bsc4I CCNNNNNNNGG 1 cut(s) 93
Bse1I ACTGG 1 cut(s) 162
BseDI CCNNGG 2 cut(s) 138, 189
BseGI GGATG 1 cut(s) 187
BseLI CCNNNNNNNGG 1 cut(s) 93
BseNI ACTGG 1 cut(s) 162
BseRI GAGGAG 1 cut(s) 76
BslFI GGGAC 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 93
BsmFI GGGAC 1 cut(s) 131
BspACI CCGC 3 cut(s) 97, 115, 173
BspLI GGNNCC 1 cut(s) 171
BsrI ACTGG 1 cut(s) 162
BssECI CCNNGG 2 cut(s) 138, 189
BssT1I CCWWGG 2 cut(s) 138, 189
Bst4CI ACNGT 2 cut(s) 28, 78
BstF5I GGATG 1 cut(s) 187
BstSFI CTRYAG 1 cut(s) 45
BtsCI GGATG 1 cut(s) 187
BtsIMutI CAGTG 1 cut(s) 33
CaiI CAGNNNCTG 1 cut(s) 32
CviJI RGCY 4 cut(s) 5, 32, 83, 124
CviKI_1 RGCY 4 cut(s) 5, 32, 83, 124
EciI GGCGGA 2 cut(s) 112, 162
Eco130I CCWWGG 2 cut(s) 138, 189
Eco57I CTGAAG 1 cut(s) 76
EcoT14I CCWWGG 2 cut(s) 138, 189
ErhI CCWWGG 2 cut(s) 138, 189
FaiI YATR 2 cut(s) 20, 111
FaqI GGGAC 1 cut(s) 131
FokI GGATG 1 cut(s) 194
FspBI CTAG 1 cut(s) 205
HinfI GANTC 1 cut(s) 134
HpyCH4III ACNGT 2 cut(s) 28, 78
HpyCH4IV ACGT 1 cut(s) 102
HpySE526I ACGT 1 cut(s) 102
LpnPI CCDG 3 cut(s) 18, 79, 143
MaeI CTAG 1 cut(s) 205
MaeII ACGT 1 cut(s) 102
MboII GAAGA 3 cut(s) 82, 140, 143
MnlI CCTC 2 cut(s) 54, 187
NlaIV GGNNCC 1 cut(s) 171
PfeI GAWTC 1 cut(s) 134
PspN4I GGNNCC 1 cut(s) 171
PstNI CAGNNNCTG 1 cut(s) 32
SetI ASST 3 cut(s) 85, 105, 171
SfcI CTRYAG 1 cut(s) 45
SgeI CNNG 7 cut(s) 45, 106, 130, 137, 151, 170, 202
SsiI CCGC 3 cut(s) 97, 115, 173
SspMI CTAG 1 cut(s) 205
StyI CCWWGG 2 cut(s) 138, 189
TaaI ACNGT 2 cut(s) 28, 78
TaiI ACGT 1 cut(s) 105
TfiI GAWTC 1 cut(s) 134
TscAI CASTG 1 cut(s) 33
TspDTI ATGAA 1 cut(s) 7
TspRI CASTG 1 cut(s) 33
XspI CTAG 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.