Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000809.1

Orthogroup ID

OG0007875

Physical Location & Seq

Genomic Coordinates Reverse (-)

153276 .. 156285

Gene Structure 3010 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000809.1_g000035.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 366 bp

atgttcccatcatcttttctgcttttattgccaattagtcgcaaggtaaagtttgaaagccgatttccaacgttaactctctgtcactcgtgcagtactgtgaagaaggttgtgtttcctcgtcgtcaatccttcaggtttgggagaagcacaagaaatatggctttgacaaacttcatactgacagtggcgggtgtgagtgctgtagttcttttattgaggagtgatgtgaaacagtcagctaccatatttaggcggaacgtcaaacatatccgaaagtggcttgaagaagaatccaaggcagtcccgaaggaacttgaaacaaaggttccgccgaaggatcttcgcaaggaggacaaacactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

121

Amino Acids

14.03

Weight (kDa)

10.82

Isoelectric Point (pI)

76.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007875)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G14105
fragaria_vesca	FvH4_5g10930
malus_domestica	MD06G1118400.v1.1 MD14G1126500.v1.1
prunus_persica	Prupe.2G009500_v2.0.a1 Prupe.5G129500_v2.0.a1
pyrus_communis	pycom14g11110
rosa_chinensis	RchiOBHm_Chr1g0371371 RchiOBHm_Chr7g0186891
rosa_multiflora	Rmu_sc0000809.1_g000035 Rmu_sc0027221.1_g000005
rosa_rugosa	Rorug01G0363400.1 Rorug06G0477900
rosa_samantha	Rh1AG373400 Rh1BG336900 Rh1CG350300 Rh1DG367900 Rh7AG083500 Rh7BG079300 Rh7CG084500 Rh7DG085400
rosa_wichuraiana	Rw1G032850 Rw6G016370 Rw7G007350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	3 cut(s)	191, 256, 332
AclI	AACGTT	1 cut(s)	71
AclWI	GGATC	1 cut(s)	348
AcuI	CTGAAG	1 cut(s)	118
AfaI	GTAC	1 cut(s)	97
AfiI	CCNNNNNNNGG	1 cut(s)	252
AgsI	TTSAA	3 cut(s)	56, 287, 320
AluBI	AGCT	1 cut(s)	242
AluI	AGCT	1 cut(s)	242
AlwI	GGATC	1 cut(s)	348
BauI	CACGAG	1 cut(s)	88
BccI	CCATC	1 cut(s)	16
BfaI	CTAG	1 cut(s)	364
BfmI	CTRYAG	1 cut(s)	204
BmcAI	AGTACT	1 cut(s)	97
BmiI	GGNNCC	1 cut(s)	330
BsaJI	CCNNGG	1 cut(s)	297
Bsc4I	CCNNNNNNNGG	1 cut(s)	252
BseDI	CCNNGG	1 cut(s)	297
BseLI	CCNNNNNNNGG	1 cut(s)	252
BseRI	GAGGAG	1 cut(s)	235
BsgI	GTGCAG	1 cut(s)	112
BslFI	GGGAC	1 cut(s)	290
BslI	CCNNNNNNNGG	1 cut(s)	252
BsmFI	GGGAC	1 cut(s)	290
Bsp143I	GATC	1 cut(s)	340
BspACI	CCGC	3 cut(s)	191, 256, 332
BspLI	GGNNCC	1 cut(s)	330
BspPI	GGATC	1 cut(s)	348
BssECI	CCNNGG	1 cut(s)	297
BssMI	GATC	1 cut(s)	340
BssSI	CACGAG	1 cut(s)	88
BssT1I	CCWWGG	1 cut(s)	297
Bst2BI	CACGAG	1 cut(s)	88
Bst4CI	ACNGT	3 cut(s)	100, 187, 237
BstKTI	GATC	1 cut(s)	343
BstMBI	GATC	1 cut(s)	340
BstMWI	GCNNNNNNNGC	1 cut(s)	28
BstSFI	CTRYAG	1 cut(s)	204
BstX2I	RGATCY	1 cut(s)	340
BstYI	RGATCY	1 cut(s)	340
BtsIMutI	CAGTG	1 cut(s)	192
Csp6I	GTAC	1 cut(s)	96
CviJI	RGCY	4 cut(s)	60, 164, 242, 283
CviKI_1	RGCY	4 cut(s)	60, 164, 242, 283
CviQI	GTAC	1 cut(s)	96
DpnI	GATC	1 cut(s)	342
DpnII	GATC	1 cut(s)	340
EciI	GGCGGA	2 cut(s)	271, 321
Eco130I	CCWWGG	1 cut(s)	297
Eco57I	CTGAAG	1 cut(s)	118
EcoT14I	CCWWGG	1 cut(s)	297
ErhI	CCWWGG	1 cut(s)	297
FaiI	YATR	4 cut(s)	161, 179, 248, 270
FaqI	GGGAC	1 cut(s)	290
FauI	CCCGC	1 cut(s)	184
FspBI	CTAG	1 cut(s)	364
HincII	GTYRAC	1 cut(s)	75
HindII	GTYRAC	1 cut(s)	75
HinfI	GANTC	1 cut(s)	293
HpaI	GTTAAC	1 cut(s)	75
Hpy166II	GTNNAC	1 cut(s)	75
Hpy188I	TCNGA	1 cut(s)	275
Hpy188III	TCNNGA	1 cut(s)	307
Hpy8I	GTNNAC	1 cut(s)	75
Hpy99I	CGWCG	1 cut(s)	126
HpyAV	CCTTC	4 cut(s)	100, 142, 304, 331
HpyCH4III	ACNGT	3 cut(s)	100, 187, 237
HpyCH4IV	ACGT	2 cut(s)	71, 261
HpyCH4V	TGCA	1 cut(s)	93
HpyF10VI	GCNNNNNNNGC	1 cut(s)	28
HpySE526I	ACGT	2 cut(s)	71, 261
KspAI	GTTAAC	1 cut(s)	75
Kzo9I	GATC	1 cut(s)	340
LpnPI	CCDG	1 cut(s)	121
MaeI	CTAG	1 cut(s)	364
MaeII	ACGT	2 cut(s)	71, 261
MaeIII	GTNAC	1 cut(s)	83
MalI	GATC	1 cut(s)	342
MboI	GATC	1 cut(s)	340
MboII	GAAGA	4 cut(s)	115, 299, 302, 335
MflI	RGATCY	1 cut(s)	340
MluCI	AATT	1 cut(s)	33
MmeI	TCCRAC	1 cut(s)	92
MnlI	CCTC	3 cut(s)	129, 213, 346
MseI	TTAA	1 cut(s)	74
MwoI	GCNNNNNNNGC	1 cut(s)	28
NdeII	GATC	1 cut(s)	340
NlaIV	GGNNCC	1 cut(s)	330
NmuCI	GTSAC	1 cut(s)	83
PfeI	GAWTC	1 cut(s)	293
Psp1406I	AACGTT	1 cut(s)	71
PspN4I	GGNNCC	1 cut(s)	330
PsuI	RGATCY	1 cut(s)	340
RsaI	GTAC	1 cut(s)	97
RsaNI	GTAC	1 cut(s)	96
SaqAI	TTAA	1 cut(s)	74
Sau3AI	GATC	1 cut(s)	340
ScaI	AGTACT	1 cut(s)	97
SetI	ASST	7 cut(s)	48, 74, 111, 140, 244, 264, 330
SfcI	CTRYAG	1 cut(s)	204
Sse9I	AATT	1 cut(s)	33
SsiI	CCGC	3 cut(s)	191, 256, 332
SspMI	CTAG	1 cut(s)	364
StyI	CCWWGG	1 cut(s)	297
TaaI	ACNGT	3 cut(s)	100, 187, 237
TaiI	ACGT	2 cut(s)	74, 264
TasI	AATT	1 cut(s)	33
TatI	WGTACW	1 cut(s)	95
TfiI	GAWTC	1 cut(s)	293
Tru1I	TTAA	1 cut(s)	74
Tru9I	TTAA	1 cut(s)	74
TscAI	CASTG	1 cut(s)	192
TseFI	GTSAC	1 cut(s)	83
Tsp45I	GTSAC	1 cut(s)	83
TspDTI	ATGAA	1 cut(s)	166
TspRI	CASTG	1 cut(s)	192
XspI	CTAG	1 cut(s)	364
ZrmI	AGTACT	1 cut(s)	97

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.