MD00G1175700.v1.1

Belongs to the Glu Leu Phe Val dehydrogenases family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
40686634 .. 40687605
972 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1175700.v1.1.491

Sequence Viewer

Length: 258 bp
ATGAATCCATTAGTTGAGTGTACTATGCCAAAAGACGATGGCAGTTTGGCTTATTTGTTGGCTTCAGGGTTCAAACATGACAATGCTAGAGGCCCCATGAAGGGAGGAATCAGATATCACCCAGGGACCATGGCATGGATACTAGACGAATACTCAAAGTTTCATGGCTACTCACCTGCAGTAGTGACTGGAAAACCTATTGTAAGTAAATCATGGAATGTGCTTAATGGTTTTGCATTGGTTGCTGTTGTTGCATAA

Protein Analysis

86

Amino Acids

9.2

Weight (kDa)

8.82

Isoelectric Point (pI)

22.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ELFV_dehydrog_N PF02812 5 - 61 2.1e-07 Glu/Leu/Phe/Val dehydrogenase, dimerisation domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 184
Acc36I ACCTGC 1 cut(s) 184
AccB7I CCANNNNNTGG 1 cut(s) 135
AcuI CTGAAG 1 cut(s) 48
AfaI GTAC 1 cut(s) 22
AfiI CCNNNNNNNGG 3 cut(s) 100, 101, 135
AgsI TTSAA 1 cut(s) 73
AjnI CCWGG 1 cut(s) 121
AoxI GGCC 1 cut(s) 91
AspS9I GGNCC 2 cut(s) 92, 126
AsuHPI GGTGA 2 cut(s) 110, 165
AvaII GGWCC 1 cut(s) 126
BccI CCATC 1 cut(s) 32
BciT130I CCWGG 1 cut(s) 123
BciVI GTATCC 1 cut(s) 132
BfaI CTAG 2 cut(s) 87, 143
BfmI CTRYAG 1 cut(s) 177
BfuAI ACCTGC 1 cut(s) 184
BfuI GTATCC 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 123
Bme18I GGWCC 1 cut(s) 126
BmgT120I GGNCC 2 cut(s) 92, 126
BmiI GGNNCC 2 cut(s) 94, 127
BmrFI CCNGG 1 cut(s) 123
BsaJI CCNNGG 3 cut(s) 121, 122, 129
Bsc4I CCNNNNNNNGG 3 cut(s) 100, 101, 135
Bse1I ACTGG 1 cut(s) 193
BseBI CCWGG 1 cut(s) 123
BseDI CCNNGG 3 cut(s) 121, 122, 129
BseLI CCNNNNNNNGG 3 cut(s) 100, 101, 135
BseNI ACTGG 1 cut(s) 193
BshFI GGCC 1 cut(s) 93
BslFI GGGAC 1 cut(s) 139
BslI CCNNNNNNNGG 3 cut(s) 100, 101, 135
BsmFI GGGAC 1 cut(s) 139
BsnI GGCC 1 cut(s) 93
Bsp19I CCATGG 1 cut(s) 129
BspANI GGCC 1 cut(s) 93
BspLI GGNNCC 2 cut(s) 94, 127
BspMAI CTGCAG 1 cut(s) 181
BspMI ACCTGC 1 cut(s) 184
BsrI ACTGG 1 cut(s) 193
BssECI CCNNGG 3 cut(s) 121, 122, 129
BssT1I CCWWGG 1 cut(s) 129
Bst2UI CCWGG 1 cut(s) 123
BstAPI GCANNNNNTGC 1 cut(s) 242
BstDSI CCRYGG 1 cut(s) 129
BstMWI GCNNNNNNNGC 2 cut(s) 242, 251
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 1 cut(s) 121
BstSFI CTRYAG 1 cut(s) 177
BsuI GTATCC 1 cut(s) 132
BsuRI GGCC 1 cut(s) 93
BtgI CCRYGG 1 cut(s) 129
BveI ACCTGC 1 cut(s) 184
Cfr13I GGNCC 2 cut(s) 92, 126
Csp6I GTAC 1 cut(s) 21
CviAII CATG 6 cut(s) 77, 97, 130, 135, 164, 213
CviJI RGCY 4 cut(s) 50, 62, 93, 168
CviKI_1 RGCY 4 cut(s) 50, 62, 93, 168
CviQI GTAC 1 cut(s) 21
Eco130I CCWWGG 1 cut(s) 129
Eco32I GATATC 1 cut(s) 116
Eco47I GGWCC 1 cut(s) 126
Eco57I CTGAAG 1 cut(s) 48
EcoO109I RGGNCCY 1 cut(s) 92
EcoRII CCWGG 1 cut(s) 121
EcoRV GATATC 1 cut(s) 116
EcoT14I CCWWGG 1 cut(s) 129
ErhI CCWWGG 1 cut(s) 129
FaeI CATG 6 cut(s) 80, 100, 133, 138, 167, 216
FaiI YATR 8 cut(s) 26, 78, 98, 131, 136, 165, 214, 256
FaqI GGGAC 1 cut(s) 139
FatI CATG 6 cut(s) 76, 96, 129, 134, 163, 212
FspBI CTAG 2 cut(s) 87, 143
HaeIII GGCC 1 cut(s) 93
Hin1II CATG 6 cut(s) 80, 100, 133, 138, 167, 216
HinfI GANTC 2 cut(s) 4, 108
HphI GGTGA 2 cut(s) 110, 165
Hpy166II GTNNAC 1 cut(s) 21
Hpy188I TCNGA 1 cut(s) 113
Hpy8I GTNNAC 1 cut(s) 21
HpyAV CCTTC 1 cut(s) 94
HpyCH4V TGCA 3 cut(s) 179, 236, 254
HpyF10VI GCNNNNNNNGC 2 cut(s) 242, 251
Hsp92II CATG 6 cut(s) 80, 100, 133, 138, 167, 216
LpnPI CCDG 5 cut(s) 51, 108, 135, 174, 189
MaeI CTAG 2 cut(s) 87, 143
MaeIII GTNAC 1 cut(s) 184
MnlI CCTC 2 cut(s) 83, 98
MseI TTAA 1 cut(s) 225
MslI CAYNNNNRTG 1 cut(s) 81
MspR9I CCNGG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 123
MwoI GCNNNNNNNGC 2 cut(s) 242, 251
NcoI CCATGG 1 cut(s) 129
NlaIII CATG 6 cut(s) 80, 100, 133, 138, 167, 216
NlaIV GGNNCC 2 cut(s) 94, 127
NmuCI GTSAC 1 cut(s) 184
PaqCI CACCTGC 1 cut(s) 184
PasI CCCWGGG 1 cut(s) 122
PfeI GAWTC 2 cut(s) 4, 108
PflMI CCANNNNNTGG 1 cut(s) 135
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
PspN4I GGNNCC 2 cut(s) 94, 127
PspPI GGNCC 2 cut(s) 92, 126
PstI CTGCAG 1 cut(s) 181
RsaI GTAC 1 cut(s) 22
RsaNI GTAC 1 cut(s) 21
RseI CAYNNNNRTG 1 cut(s) 81
SaqAI TTAA 1 cut(s) 225
Sau96I GGNCC 2 cut(s) 92, 126
ScrFI CCNGG 1 cut(s) 123
SetI ASST 2 cut(s) 178, 199
SfcI CTRYAG 1 cut(s) 177
SinI GGWCC 1 cut(s) 126
SmiMI CAYNNNNRTG 1 cut(s) 81
SspMI CTAG 2 cut(s) 87, 143
StyD4I CCNGG 1 cut(s) 121
StyI CCWWGG 1 cut(s) 129
TatI WGTACW 1 cut(s) 20
TfiI GAWTC 2 cut(s) 4, 108
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TseFI GTSAC 1 cut(s) 184
Tsp45I GTSAC 1 cut(s) 184
TspDTI ATGAA 3 cut(s) 17, 113, 152
Van91I CCANNNNNTGG 1 cut(s) 135
VpaK11BI GGWCC 1 cut(s) 126
XspI CTAG 2 cut(s) 87, 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.