MD15G1086100.v1.1

Belongs to the Glu Leu Phe Val dehydrogenases family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
5969226 .. 5984587
15362 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1086100.v1.1.491

Sequence Viewer

Length: 237 bp
ATGCACGATCTTATCGGAATCCACACCGATGTTCCAGCACCAGATATGGGGATGACCATGGCATGGATACTAGACAAATACTCAAAGTTTCATGGCTACTCACCTGCACTAGTGACTGGAAAACCTATTGTTGGAACCCTGATTATGGGAGGAAGAATACGCTTCATTGCCATCTTTAGGAAGTATCTGGGAAAAGAAAAGGGGAAGGAAACAAGAGCCGAAATCAAAACAAAGTGA

Protein Analysis

79

Amino Acids

8.75

Weight (kDa)

9.85

Isoelectric Point (pI)

23.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 112
Acc36I ACCTGC 1 cut(s) 112
AccB7I CCANNNNNTGG 1 cut(s) 63
AfiI CCNNNNNNNGG 5 cut(s) 47, 63, 131, 145, 177
AhlI ACTAGT 1 cut(s) 109
AsuHPI GGTGA 1 cut(s) 93
BccI CCATC 1 cut(s) 179
BciVI GTATCC 1 cut(s) 60
BcuI ACTAGT 1 cut(s) 109
BfaI CTAG 2 cut(s) 71, 110
BfuAI ACCTGC 1 cut(s) 112
BfuI GTATCC 1 cut(s) 60
BmiI GGNNCC 1 cut(s) 136
BsaJI CCNNGG 1 cut(s) 57
Bsc4I CCNNNNNNNGG 5 cut(s) 47, 63, 131, 145, 177
Bse1I ACTGG 1 cut(s) 121
Bse3DI GCAATG 1 cut(s) 165
BseDI CCNNGG 1 cut(s) 57
BseGI GGATG 1 cut(s) 57
BseLI CCNNNNNNNGG 5 cut(s) 47, 63, 131, 145, 177
BseMI GCAATG 1 cut(s) 165
BseNI ACTGG 1 cut(s) 121
BsgI GTGCAG 1 cut(s) 90
BslI CCNNNNNNNGG 5 cut(s) 47, 63, 131, 145, 177
Bsp143I GATC 1 cut(s) 7
Bsp19I CCATGG 1 cut(s) 57
BspLI GGNNCC 1 cut(s) 136
BspMI ACCTGC 1 cut(s) 112
BsrDI GCAATG 1 cut(s) 165
BsrI ACTGG 1 cut(s) 121
BssECI CCNNGG 1 cut(s) 57
BssMI GATC 1 cut(s) 7
BssT1I CCWWGG 1 cut(s) 57
BstDSI CCRYGG 1 cut(s) 57
BstF5I GGATG 1 cut(s) 57
BstKTI GATC 1 cut(s) 10
BstMBI GATC 1 cut(s) 7
BsuI GTATCC 1 cut(s) 60
BtgI CCRYGG 1 cut(s) 57
BtsCI GGATG 1 cut(s) 57
BveI ACCTGC 1 cut(s) 112
CviAII CATG 3 cut(s) 58, 63, 92
CviJI RGCY 2 cut(s) 96, 218
CviKI_1 RGCY 2 cut(s) 96, 218
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
Eco130I CCWWGG 1 cut(s) 57
EcoT14I CCWWGG 1 cut(s) 57
ErhI CCWWGG 1 cut(s) 57
FaeI CATG 3 cut(s) 61, 66, 95
FaiI YATR 5 cut(s) 47, 59, 64, 93, 146
FatI CATG 3 cut(s) 57, 62, 91
FokI GGATG 1 cut(s) 64
FspBI CTAG 2 cut(s) 71, 110
Hin1II CATG 3 cut(s) 61, 66, 95
HinfI GANTC 1 cut(s) 18
HphI GGTGA 1 cut(s) 93
Hpy188I TCNGA 1 cut(s) 17
HpyAV CCTTC 1 cut(s) 199
HpyCH4V TGCA 2 cut(s) 4, 107
Hsp92II CATG 3 cut(s) 61, 66, 95
Kzo9I GATC 1 cut(s) 7
LpnPI CCDG 6 cut(s) 48, 54, 102, 117, 152, 173
MaeI CTAG 2 cut(s) 71, 110
MaeIII GTNAC 1 cut(s) 112
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MboII GAAGA 1 cut(s) 165
MmeI TCCRAC 1 cut(s) 112
MnlI CCTC 1 cut(s) 143
MslI CAYNNNNRTG 1 cut(s) 27
NcoI CCATGG 1 cut(s) 57
NdeII GATC 1 cut(s) 7
NlaIII CATG 3 cut(s) 61, 66, 95
NlaIV GGNNCC 1 cut(s) 136
NmuCI GTSAC 1 cut(s) 112
PaqCI CACCTGC 1 cut(s) 112
PfeI GAWTC 1 cut(s) 18
PflMI CCANNNNNTGG 1 cut(s) 63
PspN4I GGNNCC 1 cut(s) 136
RseI CAYNNNNRTG 1 cut(s) 27
Sau3AI GATC 1 cut(s) 7
SetI ASST 2 cut(s) 106, 127
SmiMI CAYNNNNRTG 1 cut(s) 27
SpeI ACTAGT 1 cut(s) 109
SspMI CTAG 2 cut(s) 71, 110
StyI CCWWGG 1 cut(s) 57
TfiI GAWTC 1 cut(s) 18
TseFI GTSAC 1 cut(s) 112
Tsp45I GTSAC 1 cut(s) 112
TspDTI ATGAA 2 cut(s) 80, 154
Van91I CCANNNNNTGG 1 cut(s) 63
XspI CTAG 2 cut(s) 71, 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.