MD00G1176900.v1.1

Belongs to the multi antimicrobial extrusion (MATE) (TC 2.A.66.1) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
OG0001524
Physical Location & Seq
Reverse (-)
41120550 .. 41121001
452 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1176900.v1.1.491

Sequence Viewer

Length: 294 bp
ATGAACATCTTTAATTATATCTCAAAGATATTTAATATCCCTCTCCTCAGTGTTGCTACATCTTTTGTTGCTGAAGACCTTGCTAAGAGTGAAAAAAATGGTTATCTAGACGGCAATACTAATGGTAAACCCAAACCTTTTGATGGAATCGTTGAGAGAAAGCAGCTATCTTCAGTGTCTACAGCTTTATTGTTAGCAGTTGGGATTGGAATCTTTGAGGCCGTGGCCCTGTCCTTGGGATCTGGGTTGTTTCTAAATATGATGGGCATATCATCAGTAGGTTACTTGATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MatE Polysacc_synt_C

Protein Analysis

98

Amino Acids

10.3

Weight (kDa)

6.11

Isoelectric Point (pI)

14.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 179
AclWI GGATC 1 cut(s) 247
AcuI CTGAAG 2 cut(s) 93, 156
AfiI CCNNNNNNNGG 2 cut(s) 143, 235
AluBI AGCT 2 cut(s) 166, 185
AluI AGCT 2 cut(s) 166, 185
AlwI GGATC 1 cut(s) 247
AoxI GGCC 2 cut(s) 219, 225
ApeKI GCWGC 1 cut(s) 163
AspS9I GGNCC 1 cut(s) 226
BbsI GAAGAC 1 cut(s) 81
BbvI GCAGC 1 cut(s) 175
BccI CCATC 2 cut(s) 137, 256
BceAI ACGGC 2 cut(s) 127, 206
BfaI CTAG 1 cut(s) 107
BfmI CTRYAG 1 cut(s) 180
BisI GCNGC 1 cut(s) 164
BlsI GCNGC 1 cut(s) 165
BmgT120I GGNCC 1 cut(s) 226
BpiI GAAGAC 1 cut(s) 81
BsaBI GATNNNNATC 1 cut(s) 209
BsaJI CCNNGG 2 cut(s) 222, 234
Bsc4I CCNNNNNNNGG 2 cut(s) 143, 235
Bse8I GATNNNNATC 1 cut(s) 209
BseDI CCNNGG 2 cut(s) 222, 234
BseJI GATNNNNATC 1 cut(s) 209
BseLI CCNNNNNNNGG 2 cut(s) 143, 235
BseMII CTCAG 1 cut(s) 61
BseRI GAGGAG 1 cut(s) 35
BseXI GCAGC 1 cut(s) 175
BshFI GGCC 2 cut(s) 221, 227
BslI CCNNNNNNNGG 2 cut(s) 143, 235
BsnI GGCC 2 cut(s) 221, 227
Bsp143I GATC 2 cut(s) 239, 288
BspANI GGCC 2 cut(s) 221, 227
BspCNI CTCAG 1 cut(s) 60
BspPI GGATC 1 cut(s) 247
BssECI CCNNGG 2 cut(s) 222, 234
BssMI GATC 2 cut(s) 239, 288
BssT1I CCWWGG 1 cut(s) 234
BstDEI CTNAG 2 cut(s) 47, 84
BstDSI CCRYGG 1 cut(s) 222
BstKTI GATC 2 cut(s) 242, 291
BstMBI GATC 2 cut(s) 239, 288
BstSFI CTRYAG 1 cut(s) 180
BstV1I GCAGC 1 cut(s) 175
BstV2I GAAGAC 1 cut(s) 81
BstX2I RGATCY 1 cut(s) 239
BstYI RGATCY 1 cut(s) 239
BsuRI GGCC 2 cut(s) 221, 227
BtgI CCRYGG 1 cut(s) 222
BtsIMutI CAGTG 2 cut(s) 55, 180
Cfr13I GGNCC 1 cut(s) 226
CviJI RGCY 4 cut(s) 166, 185, 221, 227
CviKI_1 RGCY 4 cut(s) 166, 185, 221, 227
DdeI CTNAG 2 cut(s) 47, 84
DpnI GATC 2 cut(s) 241, 290
DpnII GATC 2 cut(s) 239, 288
Eco130I CCWWGG 1 cut(s) 234
Eco57I CTGAAG 2 cut(s) 93, 156
EcoT14I CCWWGG 1 cut(s) 234
ErhI CCWWGG 1 cut(s) 234
FaiI YATR 3 cut(s) 18, 260, 269
FblI GTMKAC 1 cut(s) 179
Fnu4HI GCNGC 1 cut(s) 164
Fsp4HI GCNGC 1 cut(s) 164
FspBI CTAG 1 cut(s) 107
GluI GCNGC 1 cut(s) 164
HaeIII GGCC 2 cut(s) 221, 227
HinfI GANTC 2 cut(s) 147, 210
Hpy166II GTNNAC 2 cut(s) 128, 180
Hpy188III TCNNGA 1 cut(s) 107
Hpy8I GTNNAC 2 cut(s) 128, 180
HpyF3I CTNAG 2 cut(s) 47, 84
Kzo9I GATC 2 cut(s) 239, 288
LpnPI CCDG 2 cut(s) 228, 242
Lsp1109I GCAGC 1 cut(s) 175
MaeI CTAG 1 cut(s) 107
MaeIII GTNAC 1 cut(s) 281
MalI GATC 2 cut(s) 241, 290
MboI GATC 2 cut(s) 239, 288
MboII GAAGA 2 cut(s) 86, 162
MflI RGATCY 1 cut(s) 239
MluCI AATT 1 cut(s) 13
MnlI CCTC 3 cut(s) 51, 56, 211
MseI TTAA 2 cut(s) 12, 33
NdeII GATC 2 cut(s) 239, 288
PfeI GAWTC 2 cut(s) 147, 210
PkrI GCNGC 1 cut(s) 165
PspPI GGNCC 1 cut(s) 226
PsuI RGATCY 1 cut(s) 239
SaqAI TTAA 2 cut(s) 12, 33
SatI GCNGC 1 cut(s) 164
Sau3AI GATC 2 cut(s) 239, 288
Sau96I GGNCC 1 cut(s) 226
SetI ASST 5 cut(s) 81, 139, 168, 187, 283
SfcI CTRYAG 1 cut(s) 180
SgeI CNNG 6 cut(s) 92, 119, 235, 241, 247, 255
Sse9I AATT 1 cut(s) 13
SspMI CTAG 1 cut(s) 107
StyI CCWWGG 1 cut(s) 234
TasI AATT 1 cut(s) 13
TfiI GAWTC 2 cut(s) 147, 210
Tru1I TTAA 2 cut(s) 12, 33
Tru9I TTAA 2 cut(s) 12, 33
TscAI CASTG 2 cut(s) 55, 180
TseI GCWGC 1 cut(s) 163
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 2 cut(s) 55, 180
XbaI TCTAGA 1 cut(s) 106
XmiI GTMKAC 1 cut(s) 179
XspI CTAG 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.