MD00G1177100.v1.1

Dof zinc finger protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Forward (+)
41133295 .. 41133738
444 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1177100.v1.1.491

Sequence Viewer

Length: 444 bp
ATGATAGGGTTGAATAATTTTGGGGGTATTAATCAACCCGGTGATGTTGAATTCCAACACCATCAGTACGGTTCGGATCGGTTGAGTGCCAGGCCAAATATTTTAGGCATGAATAATATGAGTATTTCTGAGCATTGGAGATCATCACTACTTCAGCAACAATTTCCTAATTTCTTGGCTAATTTGGAACCACCACCTAGTACTACTCATGGGATGTACCAATTGCCGTTAGATCATTCGGCGGGTAACAGAGTTACTACTACTCAGATGGTTAATGTGAAAATGGAACACAGTCATCAAGCACTGAATTTGTCAAGGAATTTTTCGGGAAGTCTGGGAAATGATCACCAATACTGGGGTACTAGTACTGCTGGTACTGGTGGCAGTGTTTGGACTGATCTTTCTGGTTTCACATCTTCTTCTTCTACCACCCATCTCTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

148

Amino Acids

16.14

Weight (kDa)

6.27

Isoelectric Point (pI)

34.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 242
AclWI GGATC 1 cut(s) 84
AcsI RAATTY 3 cut(s) 50, 307, 319
AcuI CTGAAG 1 cut(s) 137
AfaI GTAC 6 cut(s) 68, 202, 218, 361, 367, 376
AfiI CCNNNNNNNGG 1 cut(s) 355
AgsI TTSAA 2 cut(s) 13, 50
AhlI ACTAGT 1 cut(s) 362
AjnI CCWGG 1 cut(s) 89
AlwI GGATC 1 cut(s) 84
AoxI GGCC 1 cut(s) 92
ApoI RAATTY 3 cut(s) 50, 307, 319
AseI ATTAAT 1 cut(s) 30
AsuC2I CCSGG 1 cut(s) 39
AsuHPI GGTGA 2 cut(s) 53, 338
BccI CCATC 3 cut(s) 69, 262, 441
BceAI ACGGC 1 cut(s) 211
BciT130I CCWGG 1 cut(s) 91
BclI TGATCA 1 cut(s) 343
BcnI CCSGG 1 cut(s) 39
BcuI ACTAGT 1 cut(s) 362
BfaI CTAG 2 cut(s) 198, 363
BmcAI AGTACT 2 cut(s) 202, 367
Bme1390I CCNGG 2 cut(s) 39, 91
BmiI GGNNCC 1 cut(s) 189
BmrFI CCNGG 2 cut(s) 39, 91
BmrI ACTGGG 1 cut(s) 364
BmuI ACTGGG 1 cut(s) 364
BpuMI CCSGG 1 cut(s) 39
Bsc4I CCNNNNNNNGG 1 cut(s) 355
Bse1I ACTGG 2 cut(s) 359, 382
BseBI CCWGG 1 cut(s) 91
BseGI GGATG 1 cut(s) 219
BseLI CCNNNNNNNGG 1 cut(s) 355
BseMII CTCAG 2 cut(s) 120, 278
BseNI ACTGG 2 cut(s) 359, 382
BshFI GGCC 1 cut(s) 94
BsiSI CCGG 1 cut(s) 39
BslI CCNNNNNNNGG 1 cut(s) 355
BsnI GGCC 1 cut(s) 94
Bsp143I GATC 5 cut(s) 76, 140, 232, 343, 397
BspACI CCGC 1 cut(s) 242
BspANI GGCC 1 cut(s) 94
BspCNI CTCAG 2 cut(s) 121, 277
BspLI GGNNCC 1 cut(s) 189
BspPI GGATC 1 cut(s) 84
BsrI ACTGG 2 cut(s) 359, 382
BssMI GATC 5 cut(s) 76, 140, 232, 343, 397
Bst2UI CCWGG 1 cut(s) 91
Bst4CI ACNGT 2 cut(s) 71, 293
BstDEI CTNAG 2 cut(s) 129, 264
BstF5I GGATG 1 cut(s) 219
BstKTI GATC 5 cut(s) 79, 143, 235, 346, 400
BstMBI GATC 5 cut(s) 76, 140, 232, 343, 397
BstNI CCWGG 1 cut(s) 91
BstSCI CCNGG 2 cut(s) 37, 89
BsuRI GGCC 1 cut(s) 94
BtsCI GGATG 1 cut(s) 219
BtsI GCAGTG 1 cut(s) 391
BtsIMutI CAGTG 2 cut(s) 302, 391
Csp6I GTAC 6 cut(s) 67, 201, 217, 360, 366, 375
CviAII CATG 2 cut(s) 109, 209
CviJI RGCY 2 cut(s) 94, 179
CviKI_1 RGCY 2 cut(s) 94, 179
CviQI GTAC 6 cut(s) 67, 201, 217, 360, 366, 375
DdeI CTNAG 2 cut(s) 129, 264
DpnI GATC 5 cut(s) 78, 142, 234, 345, 399
DpnII GATC 5 cut(s) 76, 140, 232, 343, 397
Eco57I CTGAAG 1 cut(s) 137
EcoRI GAATTC 1 cut(s) 50
EcoRII CCWGG 1 cut(s) 89
FaeI CATG 2 cut(s) 112, 212
FaiI YATR 3 cut(s) 110, 119, 210
FatI CATG 2 cut(s) 108, 208
FauI CCCGC 1 cut(s) 235
FbaI TGATCA 1 cut(s) 343
FokI GGATG 1 cut(s) 226
FspBI CTAG 2 cut(s) 198, 363
HaeIII GGCC 1 cut(s) 94
HapII CCGG 1 cut(s) 39
Hin1II CATG 2 cut(s) 112, 212
HpaII CCGG 1 cut(s) 39
HphI GGTGA 2 cut(s) 53, 338
Hpy188I TCNGA 3 cut(s) 76, 130, 267
Hpy188III TCNNGA 1 cut(s) 327
HpyCH4III ACNGT 2 cut(s) 71, 293
HpyF3I CTNAG 2 cut(s) 129, 264
Hsp92II CATG 2 cut(s) 112, 212
Ksp22I TGATCA 1 cut(s) 343
Kzo9I GATC 5 cut(s) 76, 140, 232, 343, 397
LpnPI CCDG 8 cut(s) 52, 76, 103, 320, 340, 357, 363, 390
MaeI CTAG 2 cut(s) 198, 363
MaeIII GTNAC 2 cut(s) 245, 253
MalI GATC 5 cut(s) 78, 142, 234, 345, 399
MboI GATC 5 cut(s) 76, 140, 232, 343, 397
MboII GAAGA 3 cut(s) 408, 411, 414
MfeI CAATTG 1 cut(s) 221
MluCI AATT 8 cut(s) 16, 50, 161, 169, 181, 221, 307, 319
MmeI TCCRAC 1 cut(s) 79
MseI TTAA 2 cut(s) 30, 273
MspI CCGG 1 cut(s) 39
MspR9I CCNGG 2 cut(s) 39, 91
MunI CAATTG 1 cut(s) 221
MvaI CCWGG 1 cut(s) 91
NciI CCSGG 1 cut(s) 39
NdeII GATC 5 cut(s) 76, 140, 232, 343, 397
NlaIII CATG 2 cut(s) 112, 212
NlaIV GGNNCC 1 cut(s) 189
PshBI ATTAAT 1 cut(s) 30
Psp6I CCWGG 1 cut(s) 89
PspGI CCWGG 1 cut(s) 89
PspN4I GGNNCC 1 cut(s) 189
RsaI GTAC 6 cut(s) 68, 202, 218, 361, 367, 376
RsaNI GTAC 6 cut(s) 67, 201, 217, 360, 366, 375
SaqAI TTAA 2 cut(s) 30, 273
Sau3AI GATC 5 cut(s) 76, 140, 232, 343, 397
ScaI AGTACT 2 cut(s) 202, 367
ScrFI CCNGG 2 cut(s) 39, 91
SetI ASST 1 cut(s) 199
SpeI ACTAGT 1 cut(s) 362
Sse9I AATT 8 cut(s) 16, 50, 161, 169, 181, 221, 307, 319
SsiI CCGC 1 cut(s) 242
SspI AATATT 1 cut(s) 100
SspMI CTAG 2 cut(s) 198, 363
StyD4I CCNGG 2 cut(s) 37, 89
TaaI ACNGT 2 cut(s) 71, 293
TasI AATT 8 cut(s) 16, 50, 161, 169, 181, 221, 307, 319
TatI WGTACW 2 cut(s) 200, 365
Tru1I TTAA 2 cut(s) 30, 273
Tru9I TTAA 2 cut(s) 30, 273
TscAI CASTG 2 cut(s) 309, 391
TspDTI ATGAA 1 cut(s) 125
TspRI CASTG 2 cut(s) 309, 391
VspI ATTAAT 1 cut(s) 30
XapI RAATTY 3 cut(s) 50, 307, 319
XspI CTAG 2 cut(s) 198, 363
ZrmI AGTACT 2 cut(s) 202, 367
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.