MD01G1088500.v1.1

Serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
OG0014816
Physical Location & Seq
Forward (+)
20064777 .. 20065988
1212 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1088500.v1.1.491

Sequence Viewer

Length: 315 bp
ATGCGTTTAAGAGTGGCTCTTTATATTGCTGAAGCTTTAGATTATTGCAGTACCAAGGGTCACCCGTTATACCACGATTTGAATGCTTATAGGGTTCTCTTTGACGAGGATGGTGATCTTCGTCTTTCATGTTTTGGCTTGATGAGAAATAGTAGGGATGGGAAGAGTTACAGCACAAATCTTGCTTACACGCCACCTGAATATTTAAGAAATGGTAATAACTTCTCTAGCCTAGATATCACCTATCCCTTTGATAATTTTCTTGTCACTATTCTAGTTTTCCTATCTAAACGACTTCTGCCTGAGATATGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Pkinase Pkinase_Tyr

Protein Analysis

105

Amino Acids

12.02

Weight (kDa)

6.05

Isoelectric Point (pI)

33.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 6 - 79 4.8e-06 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 51
AfaI GTAC 1 cut(s) 52
AgsI TTSAA 1 cut(s) 82
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
AsuHPI GGTGA 3 cut(s) 53, 125, 232
BccI CCATC 2 cut(s) 104, 152
BcgI CGANNNNNNTGC 2 cut(s) 65, 99
BfaI CTAG 3 cut(s) 228, 233, 275
BsaBI GATNNNNATC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 54
Bse8I GATNNNNATC 1 cut(s) 114
BseDI CCNNGG 1 cut(s) 54
BseGI GGATG 2 cut(s) 115, 163
BseJI GATNNNNATC 1 cut(s) 114
BseMII CTCAG 1 cut(s) 294
BsmI GAATGC 1 cut(s) 88
Bsp143I GATC 1 cut(s) 115
BspCNI CTCAG 1 cut(s) 295
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 1 cut(s) 115
BssT1I CCWWGG 1 cut(s) 54
Bst6I CTCTTC 1 cut(s) 158
BstDEI CTNAG 1 cut(s) 303
BstEII GGTNACC 1 cut(s) 59
BstF5I GGATG 2 cut(s) 115, 163
BstKTI GATC 1 cut(s) 118
BstMBI GATC 1 cut(s) 115
BstPI GGTNACC 1 cut(s) 59
BtsCI GGATG 2 cut(s) 115, 163
Csp6I GTAC 1 cut(s) 51
CviAII CATG 1 cut(s) 129
CviJI RGCY 4 cut(s) 17, 35, 138, 231
CviKI_1 RGCY 4 cut(s) 17, 35, 138, 231
CviQI GTAC 1 cut(s) 51
DdeI CTNAG 1 cut(s) 303
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
Eam1104I CTCTTC 1 cut(s) 158
EarI CTCTTC 1 cut(s) 158
Eco130I CCWWGG 1 cut(s) 54
Eco32I GATATC 1 cut(s) 238
Eco57I CTGAAG 1 cut(s) 51
Eco91I GGTNACC 1 cut(s) 59
EcoO65I GGTNACC 1 cut(s) 59
EcoRV GATATC 1 cut(s) 238
EcoT14I CCWWGG 1 cut(s) 54
ErhI CCWWGG 1 cut(s) 54
FaeI CATG 1 cut(s) 132
FaiI YATR 5 cut(s) 24, 70, 90, 130, 310
FatI CATG 1 cut(s) 128
FokI GGATG 2 cut(s) 122, 170
FspBI CTAG 3 cut(s) 228, 233, 275
Hin1II CATG 1 cut(s) 132
HindIII AAGCTT 1 cut(s) 33
HphI GGTGA 3 cut(s) 53, 125, 232
HpyCH4V TGCA 1 cut(s) 48
HpyF3I CTNAG 1 cut(s) 303
Hsp92II CATG 1 cut(s) 132
Kzo9I GATC 1 cut(s) 115
LpnPI CCDG 1 cut(s) 210
MaeI CTAG 3 cut(s) 228, 233, 275
MaeIII GTNAC 3 cut(s) 59, 167, 265
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MboII GAAGA 2 cut(s) 110, 175
MluCI AATT 1 cut(s) 256
MnlI CCTC 1 cut(s) 100
MseI TTAA 2 cut(s) 8, 206
Mva1269I GAATGC 1 cut(s) 88
NdeII GATC 1 cut(s) 115
NlaIII CATG 1 cut(s) 132
NmuCI GTSAC 2 cut(s) 59, 265
PctI GAATGC 1 cut(s) 88
PspEI GGTNACC 1 cut(s) 59
RsaI GTAC 1 cut(s) 52
RsaNI GTAC 1 cut(s) 51
SaqAI TTAA 2 cut(s) 8, 206
Sau3AI GATC 1 cut(s) 115
SetI ASST 3 cut(s) 37, 199, 245
Sse9I AATT 1 cut(s) 256
SspI AATATT 1 cut(s) 203
SspMI CTAG 3 cut(s) 228, 233, 275
StyI CCWWGG 1 cut(s) 54
TasI AATT 1 cut(s) 256
Tru1I TTAA 2 cut(s) 8, 206
Tru9I TTAA 2 cut(s) 8, 206
TseFI GTSAC 2 cut(s) 59, 265
Tsp45I GTSAC 2 cut(s) 59, 265
TspDTI ATGAA 1 cut(s) 117
XspI CTAG 3 cut(s) 228, 233, 275
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.