MD01G1203300.v1.1

Hydrolyzes acetyl esters in homogalacturonan regions of pectin. In type I primary cell wall, galacturonic acid residues of pectin can be acetylated at the O-2 and O-3 positions. Decreasing the degree of acetylation of pectin gels in vitro alters their physical properties

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
OG0007825
Physical Location & Seq
Reverse (-)
29923085 .. 29926289
3205 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1203300.v1.1.491

Sequence Viewer

Length: 894 bp
ATGAATGTCGAATCACGTAAGATGTCTTTCTTGAAAGCATTAGAGTTATGTATTTTAGTCTCACTCGACTTCACACTAGTCTTACTCATATTTTACAACTGGAACCGAGTGAAGCTTAGATATTGTGATGGAGCTTCATTTGCTGGAGATGCAGTTGTTAATAACGGGACATCGTTGCTCTATTTCAGAGGGCAAAAGATTTGGGAAGCAATCATCCTTGATCTTCTGCCGAAAGGTCTAGGACAAGCGCGTAAGGCTCTTTTATCAGGTTGTTCTGCTGGTGGTTTAGCATCATTTTTGCATTGTAACAACTTCACCAAATACTTACCAAGCAACGCCAGTGTAAAATGCTTGAGTGATGCCGGATTCTTTCTCGATGAGCAGGGAGTAGAGAAGAATCTGGAGGAGAACGGTACCAAGAATTCCGTTTATCCCGAGCTGTGTTTCTTTCCACAGTATGCACTGAAATTCATCACAACACCTTTCTTCATATTGAACTCAGCCTATGACGTTTACCAGTTCCATCACATACTGGTTCCGCCTTCAGCTGATCCACGCGGACATTGGAACCGTTGCAAATTGAATCCTGCAGAATGCAATCCTGACCACCTAAATACATTGCAAGAATTCAGGCGTGATATGATTGTCGCGATGGGATTGTTCTACAAATATTCCAGAAGAGGAGGGATTTTCCTCAATTCATGCTTTGCTCATTGCCAAAGCGAGTCTCAAGACACATGGTTTGGTGATGATTCTCCAAGAGTACACAATAAGACGATTGCAGAAGCAGTAGGTGATTGGTACTTCAGCAGAACAGTAACAAGGGAAATTGATTGCCCATATCCTTGTGACACTACCTGCCATAACCTTATACCTTCGACTCAGGCCCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04310 map04310
Pfam Domains
Protein Families
PAE

Protein Analysis

298

Amino Acids

33.64

Weight (kDa)

6.69

Isoelectric Point (pI)

44.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PAE PF03283 31 - 288 8e-103 Pectinacetylesterase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 866
Acc65I GGTACC 1 cut(s) 413
AccB1I GGYRCC 1 cut(s) 413
AccII CGCG 3 cut(s) 250, 558, 650
AciI CCGC 2 cut(s) 539, 558
AclWI GGATC 1 cut(s) 545
AcsI RAATTY 3 cut(s) 421, 467, 626
AcuI CTGAAG 2 cut(s) 528, 790
AfaI GTAC 3 cut(s) 415, 765, 803
AgsI TTSAA 3 cut(s) 34, 496, 583
AhlI ACTAGT 1 cut(s) 76
AluBI AGCT 4 cut(s) 115, 134, 439, 548
AluI AGCT 4 cut(s) 115, 134, 439, 548
Alw26I GTCTC 2 cut(s) 64, 732
AlwI GGATC 1 cut(s) 545
Ama87I CYCGRG 1 cut(s) 434
AoxI GGCC 1 cut(s) 885
ApoI RAATTY 3 cut(s) 421, 467, 626
ArsI GACNNNNNNTTYG 2 cut(s) 725, 757
Asp718I GGTACC 1 cut(s) 413
AspLEI GCGC 1 cut(s) 250
AspS9I GGNCC 1 cut(s) 886
AsuHPI GGTGA 3 cut(s) 307, 758, 806
AvaI CYCGRG 1 cut(s) 434
BanI GGYRCC 1 cut(s) 413
BccI CCATC 3 cut(s) 122, 531, 646
BcoDI GTCTC 2 cut(s) 64, 732
BcuI ACTAGT 1 cut(s) 76
BfaI CTAG 2 cut(s) 77, 239
BfmI CTRYAG 1 cut(s) 588
BfuAI ACCTGC 1 cut(s) 866
BmeT110I CYCGRG 1 cut(s) 434
BmgT120I GGNCC 1 cut(s) 886
BmiI GGNNCC 4 cut(s) 104, 415, 537, 569
BmsI GCATC 3 cut(s) 139, 299, 349
BpmI CTGGAG 2 cut(s) 165, 422
BpuEI CTTGAG 2 cut(s) 373, 714
BsaAI YACGTR 1 cut(s) 17
BsaXI ACNNNNNCTCC 2 cut(s) 138, 168
Bse1I ACTGG 4 cut(s) 104, 339, 517, 537
Bse3DI GCAATG 2 cut(s) 617, 712
BseGI GGATG 1 cut(s) 213
BseMI GCAATG 2 cut(s) 617, 712
BseMII CTCAG 1 cut(s) 513
BseNI ACTGG 4 cut(s) 104, 339, 517, 537
BseRI GAGGAG 2 cut(s) 419, 696
Bsh1236I CGCG 3 cut(s) 250, 558, 650
BshFI GGCC 1 cut(s) 887
BshNI GGYRCC 1 cut(s) 413
BsiHKCI CYCGRG 1 cut(s) 434
BsiSI CCGG 1 cut(s) 363
BslFI GGGAC 1 cut(s) 181
BsmAI GTCTC 2 cut(s) 64, 732
BsmFI GGGAC 1 cut(s) 181
BsmI GAATGC 1 cut(s) 599
BsnI GGCC 1 cut(s) 887
BsoBI CYCGRG 1 cut(s) 434
Bsp143I GATC 2 cut(s) 220, 550
Bsp68I TCGCGA 1 cut(s) 650
BspACI CCGC 2 cut(s) 539, 558
BspANI GGCC 1 cut(s) 887
BspCNI CTCAG 1 cut(s) 512
BspFNI CGCG 3 cut(s) 250, 558, 650
BspLI GGNNCC 4 cut(s) 104, 415, 537, 569
BspMAI CTGCAG 1 cut(s) 592
BspMI ACCTGC 1 cut(s) 866
BspPI GGATC 1 cut(s) 545
BspT107I GGYRCC 1 cut(s) 413
BsrDI GCAATG 2 cut(s) 617, 712
BsrI ACTGG 4 cut(s) 104, 339, 517, 537
BssMI GATC 2 cut(s) 220, 550
Bst4CI ACNGT 4 cut(s) 413, 456, 572, 817
Bst6I CTCTTC 1 cut(s) 673
BstBAI YACGTR 1 cut(s) 17
BstDEI CTNAG 3 cut(s) 116, 499, 882
BstF5I GGATG 1 cut(s) 213
BstFNI CGCG 3 cut(s) 250, 558, 650
BstHHI GCGC 1 cut(s) 250
BstKTI GATC 2 cut(s) 223, 553
BstMAI GTCTC 2 cut(s) 64, 732
BstMBI GATC 2 cut(s) 220, 550
BstMWI GCNNNNNNNGC 3 cut(s) 140, 149, 254
BstSFI CTRYAG 1 cut(s) 588
BstUI CGCG 3 cut(s) 250, 558, 650
BsuRI GGCC 1 cut(s) 887
BtgZI GCGATG 1 cut(s) 665
BtsCI GGATG 1 cut(s) 213
BtsIMutI CAGTG 2 cut(s) 346, 461
BtuMI TCGCGA 1 cut(s) 650
BveI ACCTGC 1 cut(s) 866
CfoI GCGC 1 cut(s) 250
Cfr13I GGNCC 1 cut(s) 886
Csp6I GTAC 3 cut(s) 414, 764, 802
CviAII CATG 2 cut(s) 702, 738
CviJI RGCY 7 cut(s) 115, 134, 257, 439, 503, 548, 887
CviKI_1 RGCY 7 cut(s) 115, 134, 257, 439, 503, 548, 887
CviQI GTAC 3 cut(s) 414, 764, 802
DdeI CTNAG 3 cut(s) 116, 499, 882
DpnI GATC 2 cut(s) 222, 552
DpnII GATC 2 cut(s) 220, 550
Eam1104I CTCTTC 1 cut(s) 673
EarI CTCTTC 1 cut(s) 673
EciI GGCGGA 1 cut(s) 528
Eco57I CTGAAG 2 cut(s) 528, 790
Eco88I CYCGRG 1 cut(s) 434
EcoO109I RGGNCCY 1 cut(s) 886
EcoRI GAATTC 2 cut(s) 421, 626
FaeI CATG 2 cut(s) 705, 741
FaqI GGGAC 1 cut(s) 181
FatI CATG 2 cut(s) 701, 737
FokI GGATG 1 cut(s) 200
FspBI CTAG 2 cut(s) 77, 239
GlaI GCGC 1 cut(s) 249
GsuI CTGGAG 2 cut(s) 165, 422
HaeIII GGCC 1 cut(s) 887
HapII CCGG 1 cut(s) 363
HhaI GCGC 1 cut(s) 250
Hin1II CATG 2 cut(s) 705, 741
Hin6I GCGC 1 cut(s) 248
HinP1I GCGC 1 cut(s) 248
HindIII AAGCTT 1 cut(s) 113
HinfI GANTC 7 cut(s) 11, 366, 397, 583, 725, 752, 880
HpaII CCGG 1 cut(s) 363
HphI GGTGA 3 cut(s) 307, 758, 806
Hpy166II GTNNAC 2 cut(s) 514, 766
Hpy188I TCNGA 1 cut(s) 188
Hpy188III TCNNGA 8 cut(s) 31, 374, 401, 434, 602, 649, 675, 731
Hpy8I GTNNAC 2 cut(s) 514, 766
HpyAV CCTTC 2 cut(s) 552, 885
HpyCH4III ACNGT 4 cut(s) 413, 456, 572, 817
HpyCH4IV ACGT 2 cut(s) 16, 510
HpyCH4V TGCA 8 cut(s) 152, 301, 461, 576, 590, 597, 622, 782
HpyF10VI GCNNNNNNNGC 3 cut(s) 140, 149, 254
HpyF3I CTNAG 3 cut(s) 116, 499, 882
HpySE526I ACGT 2 cut(s) 16, 510
Hsp92II CATG 2 cut(s) 705, 741
HspAI GCGC 1 cut(s) 248
KpnI GGTACC 1 cut(s) 417
Kzo9I GATC 2 cut(s) 220, 550
LmnI GCTCC 1 cut(s) 131
LweI GCATC 3 cut(s) 139, 299, 349
MaeI CTAG 2 cut(s) 77, 239
MaeII ACGT 2 cut(s) 16, 510
MaeIII GTNAC 3 cut(s) 305, 817, 848
MalI GATC 2 cut(s) 222, 552
MboI GATC 2 cut(s) 220, 550
MboII GAAGA 4 cut(s) 215, 406, 478, 690
MluCI AATT 6 cut(s) 421, 467, 578, 626, 697, 828
MlyI GAGTC 2 cut(s) 734, 874
MnlI CCTC 5 cut(s) 182, 397, 674, 677, 704
MseI TTAA 2 cut(s) 159, 892
MspA1I CMGCKG 1 cut(s) 548
MspI CCGG 1 cut(s) 363
Mva1269I GAATGC 1 cut(s) 599
MvnI CGCG 3 cut(s) 250, 558, 650
MwoI GCNNNNNNNGC 3 cut(s) 140, 149, 254
NdeII GATC 2 cut(s) 220, 550
NlaIII CATG 2 cut(s) 705, 741
NlaIV GGNNCC 4 cut(s) 104, 415, 537, 569
NmuCI GTSAC 1 cut(s) 848
NruI TCGCGA 1 cut(s) 650
PctI GAATGC 1 cut(s) 599
PfeI GAWTC 5 cut(s) 11, 366, 397, 583, 752
PleI GAGTC 2 cut(s) 733, 874
PpsI GAGTC 2 cut(s) 733, 874
Ppu21I YACGTR 1 cut(s) 17
PspN4I GGNNCC 4 cut(s) 104, 415, 537, 569
PspPI GGNCC 1 cut(s) 886
PstI CTGCAG 1 cut(s) 592
PvuII CAGCTG 1 cut(s) 548
RruI TCGCGA 1 cut(s) 650
RsaI GTAC 3 cut(s) 415, 765, 803
RsaNI GTAC 3 cut(s) 414, 764, 802
SaqAI TTAA 2 cut(s) 159, 892
Sau3AI GATC 2 cut(s) 220, 550
Sau96I GGNCC 1 cut(s) 886
SchI GAGTC 2 cut(s) 734, 874
SfaNI GCATC 3 cut(s) 139, 299, 349
SfcI CTRYAG 1 cut(s) 588
SmlI CTYRAG 2 cut(s) 352, 729
SmoI CTYRAG 2 cut(s) 352, 729
SpeI ACTAGT 1 cut(s) 76
Sse9I AATT 6 cut(s) 421, 467, 578, 626, 697, 828
SsiI CCGC 2 cut(s) 539, 558
SspI AATATT 1 cut(s) 671
SspMI CTAG 2 cut(s) 77, 239
TaaI ACNGT 4 cut(s) 413, 456, 572, 817
TaiI ACGT 2 cut(s) 19, 513
TaqI TCGA 4 cut(s) 9, 66, 375, 878
TasI AATT 6 cut(s) 421, 467, 578, 626, 697, 828
TatI WGTACW 1 cut(s) 763
TfiI GAWTC 5 cut(s) 11, 366, 397, 583, 752
Tru1I TTAA 2 cut(s) 159, 892
Tru9I TTAA 2 cut(s) 159, 892
TscAI CASTG 2 cut(s) 346, 468
TseFI GTSAC 1 cut(s) 848
Tsp45I GTSAC 1 cut(s) 848
TspDTI ATGAA 5 cut(s) 17, 126, 460, 478, 690
TspGWI ACGGA 1 cut(s) 415
TspRI CASTG 2 cut(s) 346, 468
XapI RAATTY 3 cut(s) 421, 467, 626
XcmI CCANNNNNNNNNTGG 1 cut(s) 561
XspI CTAG 2 cut(s) 77, 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.