Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr02

Orthogroup ID

OG0010027

Physical Location & Seq

Genomic Coordinates Forward (+)

36257042 .. 36257580

Gene Structure 539 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD02G1307300.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

ATGGGGATAAAGCTGGTGGAGATTTTGGACCAAGGAGTCAGAATCGTCGCCAGATCTTATTCTCATTGCCCCCAGACCAGCCGCATGTACTACCATCCTCCCCCGCCCAGCCATGAAGACCACCCCACCACGGGCACCACAATCTTCACAGCGGCGGCGACATCAGTTCCGGAGGCGGCGATGTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

63

Amino Acids

6.78

Weight (kDa)

6.37

Isoelectric Point (pI)

52.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010027)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G57450
malus_domestica	MD02G1307300.v1.1
prunus_persica	Prupe.2G019800_v2.0.a1 Prupe.7G061500_v2.0.a1 Prupe.8G033700_v2.0.a1
pyrus_communis	pycom02g25850 pycom07g01410 pycom12g06330 pycom14g06130
rosa_chinensis	RchiOBHm_Chr1g0317121 RchiOBHm_Chr3g0482161 RchiOBHm_Chr3g0482181
rosa_laevigata	RLG00000030625
rosa_roxburghii	Rroxscaffold_4G00330640 Rroxscaffold_6G00399540 Rroxscaffold_6G00399670 Rroxscaffold_6G00400020
rosa_rugosa	Rorug01G0014900 Rorug03G0195500
rosa_wichuraiana	Rw1G001800 Rw3G022070

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	35
AccB1I	GGYRCC	1 cut(s)	134
AccIII	TCCGGA	1 cut(s)	169
AciI	CCGC	5 cut(s)	82, 104, 152, 155, 176
AfaI	GTAC	1 cut(s)	89
AfiI	CCNNNNNNNGG	2 cut(s)	130, 131
AluBI	AGCT	1 cut(s)	13
AluI	AGCT	1 cut(s)	13
Aor13HI	TCCGGA	1 cut(s)	169
AspS9I	GGNCC	1 cut(s)	28
AvaII	GGWCC	1 cut(s)	28
BaeGI	GKGCMC	1 cut(s)	137
BanI	GGYRCC	1 cut(s)	134
BbsI	GAAGAC	1 cut(s)	123
BccI	CCATC	1 cut(s)	102
BglII	AGATCT	1 cut(s)	53
BisI	GCNGC	4 cut(s)	82, 153, 156, 177
BlsI	GCNGC	4 cut(s)	83, 154, 157, 178
Bme18I	GGWCC	1 cut(s)	28
BmgT120I	GGNCC	1 cut(s)	28
BmiI	GGNNCC	1 cut(s)	136
BpiI	GAAGAC	1 cut(s)	123
BsaJI	CCNNGG	2 cut(s)	31, 129
BsaWI	WCCGGW	1 cut(s)	169
Bsc4I	CCNNNNNNNGG	2 cut(s)	130, 131
Bse3DI	GCAATG	1 cut(s)	64
BseAI	TCCGGA	1 cut(s)	169
BseDI	CCNNGG	2 cut(s)	31, 129
BseGI	GGATG	1 cut(s)	94
BseLI	CCNNNNNNNGG	2 cut(s)	130, 131
BseMI	GCAATG	1 cut(s)	64
BseSI	GKGCMC	1 cut(s)	137
BseYI	CCCAGC	1 cut(s)	107
BshNI	GGYRCC	1 cut(s)	134
BsiSI	CCGG	1 cut(s)	170
BslI	CCNNNNNNNGG	2 cut(s)	130, 131
Bsp1286I	GDGCHC	1 cut(s)	137
Bsp13I	TCCGGA	1 cut(s)	169
Bsp143I	GATC	1 cut(s)	53
BspACI	CCGC	5 cut(s)	82, 104, 152, 155, 176
BspEI	TCCGGA	1 cut(s)	169
BspLI	GGNNCC	1 cut(s)	136
BspT107I	GGYRCC	1 cut(s)	134
BsrDI	GCAATG	1 cut(s)	64
BssECI	CCNNGG	2 cut(s)	31, 129
BssMI	GATC	1 cut(s)	53
BssT1I	CCWWGG	1 cut(s)	31
BstDSI	CCRYGG	1 cut(s)	129
BstF5I	GGATG	1 cut(s)	94
BstKTI	GATC	1 cut(s)	56
BstMBI	GATC	1 cut(s)	53
BstNSI	RCATGY	1 cut(s)	88
BstSLI	GKGCMC	1 cut(s)	137
BstV2I	GAAGAC	1 cut(s)	123
BstX2I	RGATCY	1 cut(s)	53
BstYI	RGATCY	1 cut(s)	53
BtgI	CCRYGG	1 cut(s)	129
BtsCI	GGATG	1 cut(s)	94
Cfr13I	GGNCC	1 cut(s)	28
Csp6I	GTAC	1 cut(s)	88
CviAII	CATG	2 cut(s)	85, 113
CviJI	RGCY	3 cut(s)	13, 81, 111
CviKI_1	RGCY	3 cut(s)	13, 81, 111
CviQI	GTAC	1 cut(s)	88
DpnI	GATC	1 cut(s)	55
DpnII	GATC	1 cut(s)	53
DrdI	GACNNNNNNGTC	1 cut(s)	35
DseDI	GACNNNNNNGTC	1 cut(s)	35
Eco130I	CCWWGG	1 cut(s)	31
Eco47I	GGWCC	1 cut(s)	28
EcoT14I	CCWWGG	1 cut(s)	31
ErhI	CCWWGG	1 cut(s)	31
FaeI	CATG	2 cut(s)	88, 116
FaiI	YATR	2 cut(s)	86, 114
FatI	CATG	2 cut(s)	84, 112
FauI	CCCGC	1 cut(s)	111
Fnu4HI	GCNGC	4 cut(s)	82, 153, 156, 177
FokI	GGATG	1 cut(s)	81
Fsp4HI	GCNGC	4 cut(s)	82, 153, 156, 177
GluI	GCNGC	4 cut(s)	82, 153, 156, 177
GsaI	CCCAGC	1 cut(s)	111
HapII	CCGG	1 cut(s)	170
Hin1II	CATG	2 cut(s)	88, 116
HinfI	GANTC	2 cut(s)	36, 42
HpaII	CCGG	1 cut(s)	170
Hpy188I	TCNGA	1 cut(s)	41
Hpy188III	TCNNGA	1 cut(s)	170
Hpy99I	CGWCG	1 cut(s)	50
Hsp92II	CATG	2 cut(s)	88, 116
Kpn2I	TCCGGA	1 cut(s)	169
Kzo9I	GATC	1 cut(s)	53
LpnPI	CCDG	5 cut(s)	64, 86, 91, 121, 183
MalI	GATC	1 cut(s)	55
MboI	GATC	1 cut(s)	53
MboII	GAAGA	2 cut(s)	128, 136
MflI	RGATCY	1 cut(s)	53
MhlI	GDGCHC	1 cut(s)	137
MlyI	GAGTC	1 cut(s)	45
MnlI	CCTC	2 cut(s)	108, 166
MroI	TCCGGA	1 cut(s)	169
MspA1I	CMGCKG	1 cut(s)	152
MspI	CCGG	1 cut(s)	170
NdeII	GATC	1 cut(s)	53
NlaIII	CATG	2 cut(s)	88, 116
NlaIV	GGNNCC	1 cut(s)	136
NspI	RCATGY	1 cut(s)	88
PfeI	GAWTC	1 cut(s)	42
PkrI	GCNGC	4 cut(s)	83, 154, 157, 178
PleI	GAGTC	1 cut(s)	44
PpsI	GAGTC	1 cut(s)	44
PspFI	CCCAGC	1 cut(s)	107
PspN4I	GGNNCC	1 cut(s)	136
PspPI	GGNCC	1 cut(s)	28
PsuI	RGATCY	1 cut(s)	53
RsaI	GTAC	1 cut(s)	89
RsaNI	GTAC	1 cut(s)	88
SatI	GCNGC	4 cut(s)	82, 153, 156, 177
Sau3AI	GATC	1 cut(s)	53
Sau96I	GGNCC	1 cut(s)	28
SchI	GAGTC	1 cut(s)	45
SduI	GDGCHC	1 cut(s)	137
SetI	ASST	1 cut(s)	15
SinI	GGWCC	1 cut(s)	28
SsiI	CCGC	5 cut(s)	82, 104, 152, 155, 176
StyI	CCWWGG	1 cut(s)	31
TatI	WGTACW	1 cut(s)	87
TauI	GCSGC	4 cut(s)	84, 155, 158, 179
TfiI	GAWTC	1 cut(s)	42
TspDTI	ATGAA	1 cut(s)	129
VpaK11BI	GGWCC	1 cut(s)	28
XceI	RCATGY	1 cut(s)	88

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.