Prupe.7G061500_v2.0.a1

Encoded by

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
10050415 .. 10051008
594 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G061500.1

Sequence Viewer

Length: 261 bp
ATGGGAAAGTGGGTGGAATTATTAGATACAGGGGTGAGAATAGCAGCAAGATTTCATTCTCACTGCCCACAAACTGGACGCTTGTATTACCATCCTCCATCTGGTTCTGAAGATCAACATCATCATCACTACTTTGACCAAGCCCAGAAGCCCACCAATGGCAGCCATGCTCAATTTGATGGCATCTTCACCAGTTGCGGTGTCAAGGCAGCAGCTATGGAGGCCAACACCAATGAGGCTTTTTTGTATTCTGTTTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.62

Weight (kDa)

6.41

Isoelectric Point (pI)

22.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 74
AciI CCGC 1 cut(s) 198
AcuI CTGAAG 1 cut(s) 129
AfiI CCNNNNNNNGG 3 cut(s) 74, 101, 158
AluBI AGCT 1 cut(s) 215
AluI AGCT 1 cut(s) 215
AoxI GGCC 1 cut(s) 222
ApeKI GCWGC 4 cut(s) 44, 162, 209, 212
AsuHPI GGTGA 2 cut(s) 46, 181
BaeI ACNNNNGTAYC 2 cut(s) 18, 51
BbvI GCAGC 4 cut(s) 56, 174, 221, 224
BccI CCATC 3 cut(s) 99, 106, 173
BisI GCNGC 4 cut(s) 45, 163, 210, 213
BlsI GCNGC 4 cut(s) 46, 164, 211, 214
BmsI GCATC 1 cut(s) 192
BsaBI GATNNNNATC 1 cut(s) 117
Bsc4I CCNNNNNNNGG 3 cut(s) 74, 101, 158
Bse1I ACTGG 2 cut(s) 79, 192
Bse8I GATNNNNATC 1 cut(s) 117
BseGI GGATG 1 cut(s) 91
BseJI GATNNNNATC 1 cut(s) 117
BseLI CCNNNNNNNGG 3 cut(s) 74, 101, 158
BseNI ACTGG 2 cut(s) 79, 192
BseXI GCAGC 4 cut(s) 56, 174, 221, 224
BshFI GGCC 1 cut(s) 224
BslI CCNNNNNNNGG 3 cut(s) 74, 101, 158
BsnI GGCC 1 cut(s) 224
Bsp143I GATC 1 cut(s) 112
BspACI CCGC 1 cut(s) 198
BspANI GGCC 1 cut(s) 224
BsrI ACTGG 2 cut(s) 79, 192
BssMI GATC 1 cut(s) 112
BstF5I GGATG 1 cut(s) 91
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstMWI GCNNNNNNNGC 1 cut(s) 221
BstV1I GCAGC 4 cut(s) 56, 174, 221, 224
BsuRI GGCC 1 cut(s) 224
BtsCI GGATG 1 cut(s) 91
BtsI GCAGTG 1 cut(s) 61
BtsIMutI CAGTG 1 cut(s) 61
CseI GACGC 1 cut(s) 87
CviAII CATG 1 cut(s) 167
CviJI RGCY 6 cut(s) 143, 151, 165, 215, 224, 239
CviKI_1 RGCY 6 cut(s) 143, 151, 165, 215, 224, 239
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
Eco57I CTGAAG 1 cut(s) 129
FaeI CATG 1 cut(s) 170
FaiI YATR 2 cut(s) 168, 218
FatI CATG 1 cut(s) 166
Fnu4HI GCNGC 4 cut(s) 45, 163, 210, 213
FokI GGATG 1 cut(s) 78
Fsp4HI GCNGC 4 cut(s) 45, 163, 210, 213
GluI GCNGC 4 cut(s) 45, 163, 210, 213
HaeIII GGCC 1 cut(s) 224
HgaI GACGC 1 cut(s) 87
Hin1II CATG 1 cut(s) 170
HphI GGTGA 2 cut(s) 46, 181
Hpy188I TCNGA 1 cut(s) 109
HpyF10VI GCNNNNNNNGC 1 cut(s) 221
Hsp92II CATG 1 cut(s) 170
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 5 cut(s) 15, 60, 87, 158, 205
Lsp1109I GCAGC 4 cut(s) 56, 174, 221, 224
LweI GCATC 1 cut(s) 192
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 2 cut(s) 122, 178
MluCI AATT 2 cut(s) 17, 173
MnlI CCTC 3 cut(s) 105, 214, 229
MwoI GCNNNNNNNGC 1 cut(s) 221
NdeII GATC 1 cut(s) 112
NlaIII CATG 1 cut(s) 170
PflMI CCANNNNNTGG 1 cut(s) 74
PkrI GCNGC 4 cut(s) 46, 164, 211, 214
SatI GCNGC 4 cut(s) 45, 163, 210, 213
Sau3AI GATC 1 cut(s) 112
SetI ASST 1 cut(s) 217
SfaNI GCATC 1 cut(s) 192
Sse9I AATT 2 cut(s) 17, 173
SsiI CCGC 1 cut(s) 198
TasI AATT 2 cut(s) 17, 173
TscAI CASTG 1 cut(s) 68
TseI GCWGC 4 cut(s) 44, 162, 209, 212
TspDTI ATGAA 1 cut(s) 44
TspRI CASTG 1 cut(s) 68
Van91I CCANNNNNTGG 1 cut(s) 74
XcmI CCANNNNNNNNNTGG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.