Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr06

Orthogroup ID

OG0007687

Physical Location & Seq

Genomic Coordinates Forward (+)

15116074 .. 15118311

Gene Structure 2238 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD06G1067100.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 177 bp

ATGGGGATCCACATTGAGGGCGATAGCAGGGAAATTACAACATCTTATCTACTTCTTGGCATCTGGTATGAAGGGGAATCTCCGGGCCACAAGATAATGGCTAGCCTTGGCTTCAATGAGGAGAAAGCTAAAGAGCTTGAGTGCTCAAGTACTAAACCTGGATTCATCGACGGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009526 GO:0009532 GO:0009536 GO:0009570 GO:0009941 GO:0019899 GO:0019900 GO:0019901 GO:0031967 GO:0031975 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043424 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Clp_N

Protein Analysis

59

Amino Acids

6.37

Weight (kDa)

4.74

Isoelectric Point (pI)

62.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007687)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G12060
fragaria_vesca	FvH4_5g00880
malus_domestica	MD06G1067100.v1.1 MD17G1137600.v1.1
prunus_persica	Prupe.5G082000_v2.0.a1 Prupe.5G082000_v2.0.a1
pyrus_communis	pycom04g06840 pycom06g06470
rosa_chinensis	RchiOBHm_Chr7g0200491 RchiOBHm_Chr7g0200901
rosa_laevigata	RLG00000003721
rosa_multiflora	Rmu_sc0000617.1_g000023 Rmu_sc0000708.1_g000019
rosa_roxburghii	Rroxscaffold_3G00255920
rosa_rugosa	Rorug07G0060500 Rorug07G0060500
rosa_samantha	Rh7AG186300 Rh7BG189100 Rh7CG196400 Rh7CG196900 Rh7DG190300 Rh7DG192200
rosa_wichuraiana	Rw7G016320 Rw7G016400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	14
AfaI	GTAC	1 cut(s)	151
AfiI	CCNNNNNNNGG	1 cut(s)	16
AgsI	TTSAA	1 cut(s)	115
AjnI	CCWGG	1 cut(s)	157
AluBI	AGCT	2 cut(s)	128, 136
AluI	AGCT	2 cut(s)	128, 136
Alw21I	GWGCWC	1 cut(s)	146
AlwI	GGATC	1 cut(s)	14
AoxI	GGCC	1 cut(s)	85
AspS9I	GGNCC	1 cut(s)	85
AsuC2I	CCSGG	1 cut(s)	84
AsuNHI	GCTAGC	1 cut(s)	101
BamHI	GGATCC	1 cut(s)	6
Bbv12I	GWGCWC	1 cut(s)	146
BciT130I	CCWGG	1 cut(s)	159
BcnI	CCSGG	1 cut(s)	84
BfaI	CTAG	1 cut(s)	102
BmcAI	AGTACT	1 cut(s)	151
Bme1390I	CCNGG	2 cut(s)	84, 159
BmgT120I	GGNCC	1 cut(s)	85
BmiI	GGNNCC	1 cut(s)	8
BmrFI	CCNGG	2 cut(s)	84, 159
BmsI	GCATC	1 cut(s)	69
BmtI	GCTAGC	1 cut(s)	105
BpuEI	CTTGAG	2 cut(s)	130, 158
BpuMI	CCSGG	1 cut(s)	84
BsaJI	CCNNGG	1 cut(s)	106
Bsc4I	CCNNNNNNNGG	1 cut(s)	16
BseBI	CCWGG	1 cut(s)	159
BseDI	CCNNGG	1 cut(s)	106
BseLI	CCNNNNNNNGG	1 cut(s)	16
BseRI	GAGGAG	1 cut(s)	134
BshFI	GGCC	1 cut(s)	87
BsiHKAI	GWGCWC	1 cut(s)	146
BsiSI	CCGG	1 cut(s)	83
BslI	CCNNNNNNNGG	1 cut(s)	16
BsnI	GGCC	1 cut(s)	87
Bsp1286I	GDGCHC	1 cut(s)	146
Bsp143I	GATC	1 cut(s)	6
BspANI	GGCC	1 cut(s)	87
BspLI	GGNNCC	1 cut(s)	8
BspOI	GCTAGC	1 cut(s)	105
BspPI	GGATC	1 cut(s)	14
BssECI	CCNNGG	1 cut(s)	106
BssMI	GATC	1 cut(s)	6
BssT1I	CCWWGG	1 cut(s)	106
Bst2UI	CCWGG	1 cut(s)	159
BstC8I	GCNNGC	1 cut(s)	103
BstKTI	GATC	1 cut(s)	9
BstMBI	GATC	1 cut(s)	6
BstNI	CCWGG	1 cut(s)	159
BstSCI	CCNGG	2 cut(s)	82, 157
BstX2I	RGATCY	1 cut(s)	6
BstYI	RGATCY	1 cut(s)	6
BsuRI	GGCC	1 cut(s)	87
Cac8I	GCNNGC	1 cut(s)	103
Cfr13I	GGNCC	1 cut(s)	85
Csp6I	GTAC	1 cut(s)	150
CviJI	RGCY	6 cut(s)	87, 101, 105, 111, 128, 136
CviKI_1	RGCY	6 cut(s)	87, 101, 105, 111, 128, 136
CviQI	GTAC	1 cut(s)	150
DpnI	GATC	1 cut(s)	8
DpnII	GATC	1 cut(s)	6
Eco130I	CCWWGG	1 cut(s)	106
EcoRII	CCWGG	1 cut(s)	157
EcoT14I	CCWWGG	1 cut(s)	106
ErhI	CCWWGG	1 cut(s)	106
FaiI	YATR	1 cut(s)	69
FspBI	CTAG	1 cut(s)	102
HaeIII	GGCC	1 cut(s)	87
HapII	CCGG	1 cut(s)	83
HinfI	GANTC	2 cut(s)	77, 162
HpaII	CCGG	1 cut(s)	83
Hpy99I	CGWCG	1 cut(s)	173
HpyAV	CCTTC	1 cut(s)	65
Kzo9I	GATC	1 cut(s)	6
LpnPI	CCDG	5 cut(s)	13, 49, 96, 144, 171
LweI	GCATC	1 cut(s)	69
MaeI	CTAG	1 cut(s)	102
MalI	GATC	1 cut(s)	8
MboI	GATC	1 cut(s)	6
MflI	RGATCY	1 cut(s)	6
MhlI	GDGCHC	1 cut(s)	146
MluCI	AATT	1 cut(s)	33
MnlI	CCTC	2 cut(s)	10, 112
MspI	CCGG	1 cut(s)	83
MspR9I	CCNGG	2 cut(s)	84, 159
MvaI	CCWGG	1 cut(s)	159
NciI	CCSGG	1 cut(s)	84
NdeII	GATC	1 cut(s)	6
NheI	GCTAGC	1 cut(s)	101
NlaIV	GGNNCC	1 cut(s)	8
PfeI	GAWTC	2 cut(s)	77, 162
Psp6I	CCWGG	1 cut(s)	157
PspGI	CCWGG	1 cut(s)	157
PspN4I	GGNNCC	1 cut(s)	8
PspPI	GGNCC	1 cut(s)	85
PsuI	RGATCY	1 cut(s)	6
RsaI	GTAC	1 cut(s)	151
RsaNI	GTAC	1 cut(s)	150
Sau3AI	GATC	1 cut(s)	6
Sau96I	GGNCC	1 cut(s)	85
ScaI	AGTACT	1 cut(s)	151
ScrFI	CCNGG	2 cut(s)	84, 159
SduI	GDGCHC	1 cut(s)	146
SetI	ASST	3 cut(s)	130, 138, 160
SfaNI	GCATC	1 cut(s)	69
SmlI	CTYRAG	2 cut(s)	137, 145
SmoI	CTYRAG	2 cut(s)	137, 145
Sse9I	AATT	1 cut(s)	33
SspMI	CTAG	1 cut(s)	102
StyD4I	CCNGG	2 cut(s)	82, 157
StyI	CCWWGG	1 cut(s)	106
TaqI	TCGA	1 cut(s)	168
TasI	AATT	1 cut(s)	33
TatI	WGTACW	1 cut(s)	149
TfiI	GAWTC	2 cut(s)	77, 162
TspDTI	ATGAA	2 cut(s)	84, 154
XspI	CTAG	1 cut(s)	102
ZrmI	AGTACT	1 cut(s)	151

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.