MD06G1130200.v1.1

Mitochondrial import receptor subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0009204
Physical Location & Seq
Reverse (-)
27374420 .. 27374602
183 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1130200.v1.1.491

Sequence Viewer

Length: 183 bp
ATGGCGTCGAGAATATCTCTGAAAAGCAAGGGCAAGACTCCGACGAAGCCCTCCAAGGGCTCGGTGGCTCAATCCTTCAAGGAGTGGAGCACGCGGGCCTTGAAGAAGGCCAAGGTCGTCACCCACTACGGCTTCATTCCCTTGGTCATCATCATCGACATGAACTCAGAACCCAAGCCGTAA

Protein Analysis

61

Amino Acids

6.61

Weight (kDa)

10.42

Isoelectric Point (pI)

20.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tom7 PF08038 27 - 60 1.7e-12 TOM7 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 94
AciI CCGC 1 cut(s) 94
AcyI GRCGYC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 56
AgsI TTSAA 2 cut(s) 79, 103
Alw21I GWGCWC 1 cut(s) 92
AoxI GGCC 2 cut(s) 96, 108
AspS9I GGNCC 1 cut(s) 96
AsuHPI GGTGA 1 cut(s) 112
BanII GRGCYC 1 cut(s) 62
Bbv12I GWGCWC 1 cut(s) 92
BceAI ACGGC 2 cut(s) 145, 163
BmgT120I GGNCC 1 cut(s) 96
BplI GAGNNNNNCTC 1 cut(s) 33
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 3 cut(s) 54, 111, 141
Bsc4I CCNNNNNNNGG 1 cut(s) 56
BseDI CCNNGG 3 cut(s) 54, 111, 141
BseLI CCNNNNNNNGG 1 cut(s) 56
BseMII CTCAG 1 cut(s) 180
Bsh1236I CGCG 1 cut(s) 94
BshFI GGCC 2 cut(s) 98, 110
BsiHKAI GWGCWC 1 cut(s) 92
BslI CCNNNNNNNGG 1 cut(s) 56
BsnI GGCC 2 cut(s) 98, 110
Bsp1286I GDGCHC 2 cut(s) 62, 92
BspACI CCGC 1 cut(s) 94
BspANI GGCC 2 cut(s) 98, 110
BspCNI CTCAG 1 cut(s) 179
BspFNI CGCG 1 cut(s) 94
BssECI CCNNGG 3 cut(s) 54, 111, 141
BssNI GRCGYC 1 cut(s) 5
BssT1I CCWWGG 3 cut(s) 54, 111, 141
BstACI GRCGYC 1 cut(s) 5
BstC8I GCNNGC 2 cut(s) 92, 96
BstDEI CTNAG 1 cut(s) 166
BstFNI CGCG 1 cut(s) 94
BstUI CGCG 1 cut(s) 94
BsuRI GGCC 2 cut(s) 98, 110
Cac8I GCNNGC 2 cut(s) 92, 96
Cfr13I GGNCC 1 cut(s) 96
CviAII CATG 1 cut(s) 160
CviJI RGCY 7 cut(s) 49, 60, 68, 98, 110, 132, 178
CviKI_1 RGCY 7 cut(s) 49, 60, 68, 98, 110, 132, 178
DdeI CTNAG 1 cut(s) 166
Eco130I CCWWGG 3 cut(s) 54, 111, 141
Eco24I GRGCYC 1 cut(s) 62
EcoT14I CCWWGG 3 cut(s) 54, 111, 141
EcoT38I GRGCYC 1 cut(s) 62
ErhI CCWWGG 3 cut(s) 54, 111, 141
FaeI CATG 1 cut(s) 163
FaiI YATR 1 cut(s) 161
FatI CATG 1 cut(s) 159
FauI CCCGC 1 cut(s) 87
FriOI GRGCYC 1 cut(s) 62
HaeIII GGCC 2 cut(s) 98, 110
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 1 cut(s) 163
HinfI GANTC 1 cut(s) 37
HphI GGTGA 1 cut(s) 112
Hpy188I TCNGA 3 cut(s) 21, 42, 169
Hpy188III TCNNGA 1 cut(s) 9
Hpy99I CGWCG 2 cut(s) 10, 46
HpyAV CCTTC 2 cut(s) 85, 100
HpyF3I CTNAG 1 cut(s) 166
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 1 cut(s) 163
LmnI GCTCC 1 cut(s) 87
MaeIII GTNAC 1 cut(s) 118
MboII GAAGA 1 cut(s) 115
MhlI GDGCHC 2 cut(s) 62, 92
MlyI GAGTC 1 cut(s) 31
MmeI TCCRAC 1 cut(s) 65
MnlI CCTC 1 cut(s) 61
MslI CAYNNNNRTG 1 cut(s) 158
MvnI CGCG 1 cut(s) 94
NlaIII CATG 1 cut(s) 163
NmuCI GTSAC 1 cut(s) 118
PleI GAGTC 1 cut(s) 31
PpsI GAGTC 1 cut(s) 31
PspPI GGNCC 1 cut(s) 96
RseI CAYNNNNRTG 1 cut(s) 158
Sau96I GGNCC 1 cut(s) 96
SchI GAGTC 1 cut(s) 31
SduI GDGCHC 2 cut(s) 62, 92
SetI ASST 1 cut(s) 117
SmiMI CAYNNNNRTG 1 cut(s) 158
SsiI CCGC 1 cut(s) 94
StyI CCWWGG 3 cut(s) 54, 111, 141
TaqI TCGA 2 cut(s) 8, 156
TseFI GTSAC 1 cut(s) 118
Tsp45I GTSAC 1 cut(s) 118
TspDTI ATGAA 2 cut(s) 124, 176
XcmI CCANNNNNNNNNTGG 1 cut(s) 61
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.