MD08G1042600.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Reverse (-)
3135045 .. 3137154
2110 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1042600.v1.1.491

Sequence Viewer

Length: 177 bp
ATGATTTTTTTGGTGTTTCCCGGTCTCTCTCTCTTCTCTCCTTCATTTTCTTTTTCCCTCTCCCGTAACTCTCTCTCCCTCACTCTCTCGGCCCTCTCTATCTCAACCCCTCCGAGAGTTTTCTTACCAACAGACATCACCATCATCTTTATCTCGTTGCTACGAACTCAACCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.39

Weight (kDa)

11.7

Isoelectric Point (pI)

40.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Alw26I GTCTC 1 cut(s) 29
AoxI GGCC 1 cut(s) 90
AspS9I GGNCC 1 cut(s) 91
AsuC2I CCSGG 1 cut(s) 21
AsuHPI GGTGA 1 cut(s) 130
BccI CCATC 1 cut(s) 149
BcnI CCSGG 1 cut(s) 21
BcoDI GTCTC 1 cut(s) 29
Bme1390I CCNGG 1 cut(s) 21
BmgT120I GGNCC 1 cut(s) 91
BmrFI CCNGG 1 cut(s) 21
BpuMI CCSGG 1 cut(s) 21
BsaI GGTCTC 1 cut(s) 29
BsaXI ACNNNNNCTCC 2 cut(s) 59, 89
BshFI GGCC 1 cut(s) 92
BsiSI CCGG 1 cut(s) 21
BsmAI GTCTC 1 cut(s) 29
BsnI GGCC 1 cut(s) 92
Bso31I GGTCTC 1 cut(s) 29
BspANI GGCC 1 cut(s) 92
BspTNI GGTCTC 1 cut(s) 29
Bst6I CTCTTC 1 cut(s) 38
BstMAI GTCTC 1 cut(s) 29
BstSCI CCNGG 1 cut(s) 19
BsuRI GGCC 1 cut(s) 92
Cfr13I GGNCC 1 cut(s) 91
CviJI RGCY 1 cut(s) 92
CviKI_1 RGCY 1 cut(s) 92
Eam1104I CTCTTC 1 cut(s) 38
EarI CTCTTC 1 cut(s) 38
Eco31I GGTCTC 1 cut(s) 29
FaiI YATR 1 cut(s) 175
HaeIII GGCC 1 cut(s) 92
HapII CCGG 1 cut(s) 21
HpaII CCGG 1 cut(s) 21
HphI GGTGA 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 114
HpyAV CCTTC 1 cut(s) 51
LpnPI CCDG 1 cut(s) 34
MaeIII GTNAC 1 cut(s) 65
MboII GAAGA 1 cut(s) 25
MnlI CCTC 4 cut(s) 68, 89, 104, 120
MspI CCGG 1 cut(s) 21
MspR9I CCNGG 1 cut(s) 21
NciI CCSGG 1 cut(s) 21
NmeAIII GCCGAG 1 cut(s) 68
PspPI GGNCC 1 cut(s) 91
Sau96I GGNCC 1 cut(s) 91
ScrFI CCNGG 1 cut(s) 21
SgeI CNNG 6 cut(s) 32, 33, 75, 100, 126, 166
StyD4I CCNGG 1 cut(s) 19
TspDTI ATGAA 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.