MD08G1045300.v1.1

PITH domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
OG0008315
Physical Location & Seq
Reverse (-)
3443947 .. 3446818
2872 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1045300.v1.1.491

Sequence Viewer

Length: 297 bp
ATGGCTTGCTTGCACGACCACAGCTGCGAAGATCATGATTATTCGTCCGGTTGGACTCTCTACGAGCATATCGACCTCCCCAAGGTTTCTGCTTTGAATGAGGCAGTTCCAGGAAGCGTCAAGTCAGTTTTCAAAGCTTGGGAGCAAAGACTGAATTCTAGTGGGGGACACTTGGAGAGCAATGAGGATGATCCTGAGTTACTTGTTTACATTCCATTTCCATCAGATGTAAAGATCAAGAGCATATCAGTTGTCGGTGGTGTTGACGGAACAAGTCCTTCCAAGATGAGGGCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PITH

Protein Analysis

99

Amino Acids

10.71

Weight (kDa)

4.98

Isoelectric Point (pI)

49.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PITH PF06201 13 - 97 1e-21 PITH domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 185
AcsI RAATTY 1 cut(s) 154
AfiI CCNNNNNNNGG 2 cut(s) 82, 288
AgsI TTSAA 2 cut(s) 97, 133
AjnI CCWGG 1 cut(s) 109
AluBI AGCT 2 cut(s) 24, 137
AluI AGCT 2 cut(s) 24, 137
AlwI GGATC 1 cut(s) 185
ApeKI GCWGC 1 cut(s) 24
ApoI RAATTY 1 cut(s) 154
BbvI GCAGC 1 cut(s) 11
BccI CCATC 1 cut(s) 229
BciT130I CCWGG 1 cut(s) 111
BfaI CTAG 1 cut(s) 159
BisI GCNGC 1 cut(s) 25
BlsI GCNGC 1 cut(s) 26
Bme1390I CCNGG 1 cut(s) 111
BmrFI CCNGG 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 81
BsaWI WCCGGW 1 cut(s) 47
Bsc4I CCNNNNNNNGG 2 cut(s) 82, 288
Bse3DI GCAATG 1 cut(s) 187
BseBI CCWGG 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 81
BseGI GGATG 1 cut(s) 193
BseLI CCNNNNNNNGG 2 cut(s) 82, 288
BseMI GCAATG 1 cut(s) 187
BseMII CTCAG 1 cut(s) 186
BseXI GCAGC 1 cut(s) 11
BsiSI CCGG 1 cut(s) 48
BslFI GGGAC 1 cut(s) 180
BslI CCNNNNNNNGG 2 cut(s) 82, 288
BsmFI GGGAC 1 cut(s) 180
Bsp143I GATC 3 cut(s) 31, 190, 234
BspCNI CTCAG 1 cut(s) 187
BspHI TCATGA 1 cut(s) 34
BspPI GGATC 1 cut(s) 185
BsrDI GCAATG 1 cut(s) 187
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 3 cut(s) 31, 190, 234
BssT1I CCWWGG 1 cut(s) 81
Bst2UI CCWGG 1 cut(s) 111
BstC8I GCNNGC 2 cut(s) 7, 11
BstDEI CTNAG 1 cut(s) 195
BstENI CCTNNNNNAGG 1 cut(s) 80
BstF5I GGATG 1 cut(s) 193
BstKTI GATC 3 cut(s) 34, 193, 237
BstMBI GATC 3 cut(s) 31, 190, 234
BstNI CCWGG 1 cut(s) 111
BstSCI CCNGG 1 cut(s) 109
BstV1I GCAGC 1 cut(s) 11
BtsCI GGATG 1 cut(s) 193
Cac8I GCNNGC 2 cut(s) 7, 11
CciI TCATGA 1 cut(s) 34
CseI GACGC 1 cut(s) 106
CviAII CATG 1 cut(s) 35
CviJI RGCY 3 cut(s) 5, 24, 137
CviKI_1 RGCY 3 cut(s) 5, 24, 137
DdeI CTNAG 1 cut(s) 195
DpnI GATC 3 cut(s) 33, 192, 236
DpnII GATC 3 cut(s) 31, 190, 234
Eco130I CCWWGG 1 cut(s) 81
EcoNI CCTNNNNNAGG 1 cut(s) 80
EcoRI GAATTC 1 cut(s) 154
EcoRII CCWGG 1 cut(s) 109
EcoT14I CCWWGG 1 cut(s) 81
ErhI CCWWGG 1 cut(s) 81
FaeI CATG 1 cut(s) 38
FaiI YATR 3 cut(s) 36, 69, 245
FaqI GGGAC 1 cut(s) 180
FatI CATG 1 cut(s) 34
Fnu4HI GCNGC 1 cut(s) 25
FokI GGATG 1 cut(s) 200
Fsp4HI GCNGC 1 cut(s) 25
FspBI CTAG 1 cut(s) 159
GluI GCNGC 1 cut(s) 25
HapII CCGG 1 cut(s) 48
HgaI GACGC 1 cut(s) 106
Hin1II CATG 1 cut(s) 38
HincII GTYRAC 1 cut(s) 265
HindII GTYRAC 1 cut(s) 265
HindIII AAGCTT 1 cut(s) 135
HinfI GANTC 1 cut(s) 55
HpaII CCGG 1 cut(s) 48
Hpy166II GTNNAC 2 cut(s) 208, 265
Hpy188I TCNGA 1 cut(s) 226
Hpy188III TCNNGA 3 cut(s) 35, 194, 238
Hpy8I GTNNAC 2 cut(s) 208, 265
HpyAV CCTTC 1 cut(s) 288
HpyCH4V TGCA 1 cut(s) 13
HpyF3I CTNAG 1 cut(s) 195
Hsp92II CATG 1 cut(s) 38
Kzo9I GATC 3 cut(s) 31, 190, 234
LmnI GCTCC 1 cut(s) 142
LpnPI CCDG 4 cut(s) 61, 96, 123, 207
Lsp1109I GCAGC 1 cut(s) 11
MaeI CTAG 1 cut(s) 159
MaeIII GTNAC 1 cut(s) 198
MalI GATC 3 cut(s) 33, 192, 236
MboI GATC 3 cut(s) 31, 190, 234
MboII GAAGA 1 cut(s) 41
MluCI AATT 1 cut(s) 154
MlyI GAGTC 1 cut(s) 49
MmeI TCCRAC 1 cut(s) 32
MnlI CCTC 4 cut(s) 86, 94, 178, 282
MspA1I CMGCKG 1 cut(s) 24
MspI CCGG 1 cut(s) 48
MspR9I CCNGG 1 cut(s) 111
MvaI CCWGG 1 cut(s) 111
NdeII GATC 3 cut(s) 31, 190, 234
NlaIII CATG 1 cut(s) 38
PagI TCATGA 1 cut(s) 34
PcsI WCGNNNNNNNCGW 1 cut(s) 69
PfoI TCCNGGA 1 cut(s) 109
PkrI GCNGC 1 cut(s) 26
PleI GAGTC 1 cut(s) 49
PpsI GAGTC 1 cut(s) 49
Psp6I CCWGG 1 cut(s) 109
PspGI CCWGG 1 cut(s) 109
PvuII CAGCTG 1 cut(s) 24
SatI GCNGC 1 cut(s) 25
Sau3AI GATC 3 cut(s) 31, 190, 234
SchI GAGTC 1 cut(s) 49
ScrFI CCNGG 1 cut(s) 111
SetI ASST 4 cut(s) 26, 78, 87, 139
Sse9I AATT 1 cut(s) 154
SspMI CTAG 1 cut(s) 159
StyD4I CCNGG 1 cut(s) 109
StyI CCWWGG 1 cut(s) 81
TaqI TCGA 1 cut(s) 72
TasI AATT 1 cut(s) 154
TseI GCWGC 1 cut(s) 24
TspGWI ACGGA 1 cut(s) 282
XagI CCTNNNNNAGG 1 cut(s) 80
XapI RAATTY 1 cut(s) 154
XspI CTAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.