pycom08g03600

PITH domain-containing protein 1-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
Physical Location & Seq
Reverse (-)
2798369 .. 2799628
1260 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g03600.6

Sequence Viewer

Length: 327 bp
ATGAGGGCGTTCATCAACAAAGAAGGCATTGACTTTTCAGATGCTCAAGGAATGCAAGCTGTTCAGGAGTGGGATCTGGTCGAAAATTTCCAAGGAACGTTGGAGTACCAGACAAGATATTCCAAATTTCAAAACGTGGCCAGCATCACATTGCATTTTCCCGATTGTTTTGGTGGTGATACAACTAAGATAGAGTACATTGGCTTTAAAGGCGAAGCTACAAAGTTGAAGAGGGATGTTGTCGCAACAATTGTTTACGAACTCAGGCCAAATCCTTCCGATCACAAGACAAAGGCTGAAGGTGGGGGTCTCTCACATATTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.18

Weight (kDa)

5.34

Isoelectric Point (pI)

23.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 98
AclWI GGATC 1 cut(s) 81
AcoI YGGCCR 1 cut(s) 138
AcsI RAATTY 2 cut(s) 85, 125
AcuI CTGAAG 1 cut(s) 318
AfaI GTAC 2 cut(s) 107, 197
AgsI TTSAA 3 cut(s) 131, 229, 323
AluBI AGCT 2 cut(s) 59, 218
AluI AGCT 2 cut(s) 59, 218
Alw26I GTCTC 1 cut(s) 314
AlwI GGATC 1 cut(s) 81
AoxI GGCC 2 cut(s) 138, 266
ApoI RAATTY 2 cut(s) 85, 125
AsuHPI GGTGA 1 cut(s) 188
BalI TGGCCA 1 cut(s) 140
BcoDI GTCTC 1 cut(s) 314
BmsI GCATC 2 cut(s) 31, 153
BpuEI CTTGAG 1 cut(s) 30
BsaI GGTCTC 1 cut(s) 314
BsaJI CCNNGG 1 cut(s) 91
Bse3DI GCAATG 1 cut(s) 149
BseDI CCNNGG 1 cut(s) 91
BseGI GGATG 1 cut(s) 241
BseMI GCAATG 1 cut(s) 149
BseMII CTCAG 1 cut(s) 277
BshFI GGCC 2 cut(s) 140, 268
BsmAI GTCTC 1 cut(s) 314
BsmI GAATGC 1 cut(s) 57
BsnI GGCC 2 cut(s) 140, 268
Bso31I GGTCTC 1 cut(s) 314
Bsp143I GATC 2 cut(s) 73, 280
BspANI GGCC 2 cut(s) 140, 268
BspCNI CTCAG 1 cut(s) 276
BspPI GGATC 1 cut(s) 81
BspTNI GGTCTC 1 cut(s) 314
BsrDI GCAATG 1 cut(s) 149
BssECI CCNNGG 1 cut(s) 91
BssMI GATC 2 cut(s) 73, 280
BssT1I CCWWGG 1 cut(s) 91
Bst6I CTCTTC 1 cut(s) 224
BstC8I GCNNGC 2 cut(s) 57, 142
BstDEI CTNAG 2 cut(s) 186, 263
BstF5I GGATG 1 cut(s) 241
BstKTI GATC 2 cut(s) 76, 283
BstMAI GTCTC 1 cut(s) 314
BstMBI GATC 2 cut(s) 73, 280
BstMWI GCNNNNNNNGC 1 cut(s) 210
BstX2I RGATCY 1 cut(s) 73
BstYI RGATCY 1 cut(s) 73
BsuRI GGCC 2 cut(s) 140, 268
BtsCI GGATG 1 cut(s) 241
Cac8I GCNNGC 2 cut(s) 57, 142
Csp6I GTAC 2 cut(s) 106, 196
CviJI RGCY 6 cut(s) 59, 140, 204, 218, 268, 296
CviKI_1 RGCY 6 cut(s) 59, 140, 204, 218, 268, 296
CviQI GTAC 2 cut(s) 106, 196
DdeI CTNAG 2 cut(s) 186, 263
DpnI GATC 2 cut(s) 75, 282
DpnII GATC 2 cut(s) 73, 280
DraI TTTAAA 1 cut(s) 208
EaeI YGGCCR 1 cut(s) 138
Eam1104I CTCTTC 1 cut(s) 224
EarI CTCTTC 1 cut(s) 224
Eco130I CCWWGG 1 cut(s) 91
Eco31I GGTCTC 1 cut(s) 314
Eco57I CTGAAG 1 cut(s) 318
EcoT14I CCWWGG 1 cut(s) 91
ErhI CCWWGG 1 cut(s) 91
FaiI YATR 1 cut(s) 318
FokI GGATG 1 cut(s) 248
HaeIII GGCC 2 cut(s) 140, 268
HphI GGTGA 1 cut(s) 188
Hpy166II GTNNAC 1 cut(s) 256
Hpy188I TCNGA 2 cut(s) 40, 280
Hpy188III TCNNGA 2 cut(s) 65, 161
Hpy8I GTNNAC 1 cut(s) 256
HpyAV CCTTC 3 cut(s) 17, 285, 293
HpyCH4IV ACGT 2 cut(s) 98, 135
HpyCH4V TGCA 2 cut(s) 55, 154
HpyF10VI GCNNNNNNNGC 1 cut(s) 210
HpyF3I CTNAG 2 cut(s) 186, 263
HpySE526I ACGT 2 cut(s) 98, 135
Kzo9I GATC 2 cut(s) 73, 280
LpnPI CCDG 5 cut(s) 50, 62, 122, 154, 250
LweI GCATC 2 cut(s) 31, 153
MaeII ACGT 2 cut(s) 98, 135
MalI GATC 2 cut(s) 75, 282
MboI GATC 2 cut(s) 73, 280
MboII GAAGA 1 cut(s) 241
MfeI CAATTG 1 cut(s) 249
MflI RGATCY 1 cut(s) 73
MlsI TGGCCA 1 cut(s) 140
MluCI AATT 3 cut(s) 85, 125, 249
MluNI TGGCCA 1 cut(s) 140
MmeI TCCRAC 1 cut(s) 81
MnlI CCTC 1 cut(s) 225
Mox20I TGGCCA 1 cut(s) 140
MscI TGGCCA 1 cut(s) 140
MseI TTAA 1 cut(s) 207
Msp20I TGGCCA 1 cut(s) 140
MunI CAATTG 1 cut(s) 249
Mva1269I GAATGC 1 cut(s) 57
MwoI GCNNNNNNNGC 1 cut(s) 210
NdeII GATC 2 cut(s) 73, 280
PctI GAATGC 1 cut(s) 57
Psp1406I AACGTT 1 cut(s) 98
PsuI RGATCY 1 cut(s) 73
RsaI GTAC 2 cut(s) 107, 197
RsaNI GTAC 2 cut(s) 106, 196
SaqAI TTAA 1 cut(s) 207
Sau3AI GATC 2 cut(s) 73, 280
SetI ASST 5 cut(s) 61, 101, 138, 220, 304
SfaNI GCATC 2 cut(s) 31, 153
SmlI CTYRAG 1 cut(s) 45
SmoI CTYRAG 1 cut(s) 45
Sse9I AATT 3 cut(s) 85, 125, 249
StyI CCWWGG 1 cut(s) 91
TaiI ACGT 2 cut(s) 101, 138
TaqI TCGA 1 cut(s) 81
TasI AATT 3 cut(s) 85, 125, 249
TatI WGTACW 1 cut(s) 195
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
XapI RAATTY 2 cut(s) 85, 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.