Rmu_sc0035020.1_g000001

PITH domain-containing protein 1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0035020.1
Physical Location & Seq
Reverse (-)
1 .. 919
919 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0035020.1_g000001.1.cds

Sequence Viewer

Length: 165 bp
atggcttgcttacatgatcatagctgcgaagaacatgattgctcctctgattggtctctctacaagcatatagacctccccaaggtttctgctttaaatgaggcagttccaggcagtgtcaagtccgtgttcaaagcttgggaggaacggctgaattcatctggg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.14

Weight (kDa)

5.34

Isoelectric Point (pI)

57.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 154
AfiI CCNNNNNNNGG 2 cut(s) 51, 82
AgsI TTSAA 1 cut(s) 133
AjnI CCWGG 1 cut(s) 109
AluBI AGCT 2 cut(s) 24, 137
AluI AGCT 2 cut(s) 24, 137
Alw26I GTCTC 1 cut(s) 60
ApeKI GCWGC 1 cut(s) 24
ApoI RAATTY 1 cut(s) 154
BbvI GCAGC 1 cut(s) 11
BciT130I CCWGG 1 cut(s) 111
BclI TGATCA 1 cut(s) 16
BcoDI GTCTC 1 cut(s) 60
BisI GCNGC 1 cut(s) 25
BlsI GCNGC 1 cut(s) 26
Bme1390I CCNGG 1 cut(s) 111
BmrFI CCNGG 1 cut(s) 111
BsaI GGTCTC 1 cut(s) 60
BsaJI CCNNGG 1 cut(s) 81
Bsc4I CCNNNNNNNGG 2 cut(s) 51, 82
BseBI CCWGG 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 81
BseLI CCNNNNNNNGG 2 cut(s) 51, 82
BseRI GAGGAG 1 cut(s) 34
BseXI GCAGC 1 cut(s) 11
BslI CCNNNNNNNGG 2 cut(s) 51, 82
BsmAI GTCTC 1 cut(s) 60
Bso31I GGTCTC 1 cut(s) 60
Bsp143I GATC 1 cut(s) 16
BspTNI GGTCTC 1 cut(s) 60
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 1 cut(s) 16
BssT1I CCWWGG 1 cut(s) 81
Bst2UI CCWGG 1 cut(s) 111
BstC8I GCNNGC 1 cut(s) 7
BstENI CCTNNNNNAGG 1 cut(s) 80
BstKTI GATC 1 cut(s) 19
BstMAI GTCTC 1 cut(s) 60
BstMBI GATC 1 cut(s) 16
BstNI CCWGG 1 cut(s) 111
BstSCI CCNGG 1 cut(s) 109
BstV1I GCAGC 1 cut(s) 11
BtsI GCAGTG 1 cut(s) 121
BtsIMutI CAGTG 1 cut(s) 121
Cac8I GCNNGC 1 cut(s) 7
CviAII CATG 2 cut(s) 14, 35
CviJI RGCY 4 cut(s) 5, 24, 137, 151
CviKI_1 RGCY 4 cut(s) 5, 24, 137, 151
DpnI GATC 1 cut(s) 18
DpnII GATC 1 cut(s) 16
DraI TTTAAA 1 cut(s) 96
Eco130I CCWWGG 1 cut(s) 81
Eco31I GGTCTC 1 cut(s) 60
EcoNI CCTNNNNNAGG 1 cut(s) 80
EcoRI GAATTC 1 cut(s) 154
EcoRII CCWGG 1 cut(s) 109
EcoT14I CCWWGG 1 cut(s) 81
ErhI CCWWGG 1 cut(s) 81
FaeI CATG 2 cut(s) 17, 38
FaiI YATR 5 cut(s) 15, 21, 36, 69, 71
FatI CATG 2 cut(s) 13, 34
FbaI TGATCA 1 cut(s) 16
Fnu4HI GCNGC 1 cut(s) 25
Fsp4HI GCNGC 1 cut(s) 25
GluI GCNGC 1 cut(s) 25
Hin1II CATG 2 cut(s) 17, 38
HindIII AAGCTT 1 cut(s) 135
Hpy188I TCNGA 1 cut(s) 49
Hsp92II CATG 2 cut(s) 17, 38
Ksp22I TGATCA 1 cut(s) 16
Kzo9I GATC 1 cut(s) 16
LmnI GCTCC 1 cut(s) 47
LpnPI CCDG 3 cut(s) 96, 123, 147
Lsp1109I GCAGC 1 cut(s) 11
MalI GATC 1 cut(s) 18
MboI GATC 1 cut(s) 16
MboII GAAGA 1 cut(s) 41
MluCI AATT 1 cut(s) 154
MnlI CCTC 4 cut(s) 55, 86, 94, 136
MseI TTAA 1 cut(s) 95
MspR9I CCNGG 1 cut(s) 111
MvaI CCWGG 1 cut(s) 111
NdeII GATC 1 cut(s) 16
NlaIII CATG 2 cut(s) 17, 38
PkrI GCNGC 1 cut(s) 26
Psp6I CCWGG 1 cut(s) 109
PspGI CCWGG 1 cut(s) 109
SaqAI TTAA 1 cut(s) 95
SatI GCNGC 1 cut(s) 25
Sau3AI GATC 1 cut(s) 16
ScrFI CCNGG 1 cut(s) 111
SetI ASST 4 cut(s) 26, 78, 87, 139
Sse9I AATT 1 cut(s) 154
StyD4I CCNGG 1 cut(s) 109
StyI CCWWGG 1 cut(s) 81
TasI AATT 1 cut(s) 154
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
TscAI CASTG 1 cut(s) 121
TseI GCWGC 1 cut(s) 24
TspDTI ATGAA 1 cut(s) 147
TspGWI ACGGA 1 cut(s) 115
TspRI CASTG 1 cut(s) 121
XagI CCTNNNNNAGG 1 cut(s) 80
XapI RAATTY 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.