Rmu_sc0016392.1_g000005

PITH domain-containing protein 1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016392.1
Physical Location & Seq
Reverse (-)
18644 .. 21414
2771 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016392.1_g000005.1.cds

Sequence Viewer

Length: 546 bp
atgatcatagctgcgaagaacatgattgctcctctgattgttccaggcagtgtcaagtccgtgttcaaagcttgggaggaacggctgaattcatctgggggacatctggagagcaatgagggtgatcctgaattacttattttcattccattcacatcagatgtgaagatcaagagcatatcaattgtgggtggtgttgacggaacaagtccttccaagatgagggcgttcattaaccgagaaggcattgacttctcagatgctcaaggcatgcaagccattcaggagtgggatttggttgaaaatttccaaggagtgttggagtaccagacaagatattccaaatttcaaaatgtgggcagtatcacgttgcatttccctgatagttttggtggtgatacaaccaagattgagtatattggctttaaaggtgaagctactcagttaaagagggatgttgttgctaccatagtttatgaactcaggccaaatccttctgatcacaaaacaaaggctgaaggtgggggtctttcacatgtcgaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

181

Amino Acids

19.88

Weight (kDa)

5.27

Isoelectric Point (pI)

23.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 119
AcsI RAATTY 3 cut(s) 88, 304, 344
AcuI CTGAAG 1 cut(s) 537
AfaI GTAC 1 cut(s) 326
AfiI CCNNNNNNNGG 1 cut(s) 222
AflIII ACRYGT 1 cut(s) 535
AgsI TTSAA 3 cut(s) 67, 302, 350
AjnI CCWGG 1 cut(s) 43
AluBI AGCT 3 cut(s) 11, 71, 437
AluI AGCT 3 cut(s) 11, 71, 437
AlwI GGATC 1 cut(s) 119
AoxI GGCC 1 cut(s) 485
ApeKI GCWGC 1 cut(s) 11
ApoI RAATTY 3 cut(s) 88, 304, 344
AsuHPI GGTGA 3 cut(s) 134, 407, 443
BceAI ACGGC 1 cut(s) 98
BciT130I CCWGG 1 cut(s) 45
BclI TGATCA 2 cut(s) 3, 499
BisI GCNGC 1 cut(s) 12
BlsI GCNGC 1 cut(s) 13
Bme1390I CCNGG 1 cut(s) 45
BmrFI CCNGG 1 cut(s) 45
BmsI GCATC 1 cut(s) 250
BpmI CTGGAG 1 cut(s) 128
BpuEI CTTGAG 1 cut(s) 249
BsaJI CCNNGG 1 cut(s) 310
Bsc4I CCNNNNNNNGG 1 cut(s) 222
Bse3DI GCAATG 1 cut(s) 121
BseBI CCWGG 1 cut(s) 45
BseDI CCNNGG 1 cut(s) 310
BseGI GGATG 1 cut(s) 460
BseLI CCNNNNNNNGG 1 cut(s) 222
BseMI GCAATG 1 cut(s) 121
BseMII CTCAG 3 cut(s) 270, 455, 496
BseRI GAGGAG 1 cut(s) 21
BshFI GGCC 1 cut(s) 487
BslFI GGGAC 1 cut(s) 114
BslI CCNNNNNNNGG 1 cut(s) 222
BsmFI GGGAC 1 cut(s) 114
BsnI GGCC 1 cut(s) 487
Bsp143I GATC 4 cut(s) 3, 124, 168, 499
BspANI GGCC 1 cut(s) 487
BspCNI CTCAG 3 cut(s) 269, 454, 495
BspPI GGATC 1 cut(s) 119
BsrDI GCAATG 1 cut(s) 121
BssECI CCNNGG 1 cut(s) 310
BssMI GATC 4 cut(s) 3, 124, 168, 499
BssT1I CCWWGG 1 cut(s) 310
Bst2UI CCWGG 1 cut(s) 45
BstC8I GCNNGC 2 cut(s) 272, 276
BstDEI CTNAG 3 cut(s) 256, 441, 482
BstF5I GGATG 1 cut(s) 460
BstKTI GATC 4 cut(s) 6, 127, 171, 502
BstMBI GATC 4 cut(s) 3, 124, 168, 499
BstNI CCWGG 1 cut(s) 45
BstNSI RCATGY 2 cut(s) 274, 539
BstSCI CCNGG 1 cut(s) 43
BsuRI GGCC 1 cut(s) 487
BtsCI GGATG 1 cut(s) 460
BtsI GCAGTG 1 cut(s) 55
BtsIMutI CAGTG 1 cut(s) 55
Cac8I GCNNGC 2 cut(s) 272, 276
Csp6I GTAC 1 cut(s) 325
CviAII CATG 3 cut(s) 22, 271, 536
CviJI RGCY 8 cut(s) 11, 71, 85, 278, 423, 437, 487, 515
CviKI_1 RGCY 8 cut(s) 11, 71, 85, 278, 423, 437, 487, 515
CviQI GTAC 1 cut(s) 325
DdeI CTNAG 3 cut(s) 256, 441, 482
DpnI GATC 4 cut(s) 5, 126, 170, 501
DpnII GATC 4 cut(s) 3, 124, 168, 499
DraI TTTAAA 1 cut(s) 427
Eco130I CCWWGG 1 cut(s) 310
Eco57I CTGAAG 1 cut(s) 537
EcoRI GAATTC 1 cut(s) 88
EcoRII CCWGG 1 cut(s) 43
EcoT14I CCWWGG 1 cut(s) 310
ErhI CCWWGG 1 cut(s) 310
FaeI CATG 3 cut(s) 25, 274, 539
FaiI YATR 8 cut(s) 8, 23, 179, 272, 417, 470, 477, 537
FaqI GGGAC 1 cut(s) 114
FatI CATG 3 cut(s) 21, 270, 535
FbaI TGATCA 2 cut(s) 3, 499
Fnu4HI GCNGC 1 cut(s) 12
FokI GGATG 1 cut(s) 467
Fsp4HI GCNGC 1 cut(s) 12
GluI GCNGC 1 cut(s) 12
GsuI CTGGAG 1 cut(s) 128
HaeIII GGCC 1 cut(s) 487
Hin1II CATG 3 cut(s) 25, 274, 539
HincII GTYRAC 1 cut(s) 199
HindII GTYRAC 1 cut(s) 199
HindIII AAGCTT 1 cut(s) 69
HphI GGTGA 3 cut(s) 134, 407, 443
Hpy166II GTNNAC 1 cut(s) 199
Hpy188I TCNGA 4 cut(s) 36, 160, 259, 499
Hpy188III TCNNGA 4 cut(s) 107, 128, 172, 284
Hpy8I GTNNAC 1 cut(s) 199
HpyAV CCTTC 4 cut(s) 222, 236, 504, 512
HpyCH4IV ACGT 1 cut(s) 368
HpyCH4V TGCA 2 cut(s) 274, 373
HpyF3I CTNAG 3 cut(s) 256, 441, 482
HpySE526I ACGT 1 cut(s) 368
Hsp92II CATG 3 cut(s) 25, 274, 539
Ksp22I TGATCA 2 cut(s) 3, 499
Kzo9I GATC 4 cut(s) 3, 124, 168, 499
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 9 cut(s) 30, 57, 81, 92, 141, 269, 341, 393, 469
LweI GCATC 1 cut(s) 250
MaeII ACGT 1 cut(s) 368
MalI GATC 4 cut(s) 5, 126, 170, 501
MboI GATC 4 cut(s) 3, 124, 168, 499
MboII GAAGA 2 cut(s) 28, 178
MfeI CAATTG 1 cut(s) 183
MluCI AATT 5 cut(s) 88, 131, 183, 304, 344
MmeI TCCRAC 1 cut(s) 300
MnlI CCTC 5 cut(s) 42, 70, 112, 216, 444
MseI TTAA 3 cut(s) 234, 426, 446
MspR9I CCNGG 1 cut(s) 45
MunI CAATTG 1 cut(s) 183
MvaI CCWGG 1 cut(s) 45
NdeII GATC 4 cut(s) 3, 124, 168, 499
NlaIII CATG 3 cut(s) 25, 274, 539
NspI RCATGY 2 cut(s) 274, 539
PaeI GCATGC 1 cut(s) 274
PciI ACATGT 1 cut(s) 535
PkrI GCNGC 1 cut(s) 13
PscI ACATGT 1 cut(s) 535
Psp6I CCWGG 1 cut(s) 43
PspGI CCWGG 1 cut(s) 43
RsaI GTAC 1 cut(s) 326
RsaNI GTAC 1 cut(s) 325
SaqAI TTAA 3 cut(s) 234, 426, 446
SatI GCNGC 1 cut(s) 12
Sau3AI GATC 4 cut(s) 3, 124, 168, 499
ScrFI CCNGG 1 cut(s) 45
SetI ASST 6 cut(s) 13, 73, 371, 433, 439, 523
SfaNI GCATC 1 cut(s) 250
SmlI CTYRAG 1 cut(s) 264
SmoI CTYRAG 1 cut(s) 264
SphI GCATGC 1 cut(s) 274
Sse9I AATT 5 cut(s) 88, 131, 183, 304, 344
StyD4I CCNGG 1 cut(s) 43
StyI CCWWGG 1 cut(s) 310
TaiI ACGT 1 cut(s) 371
TaqI TCGA 1 cut(s) 540
TasI AATT 5 cut(s) 88, 131, 183, 304, 344
Tru1I TTAA 3 cut(s) 234, 426, 446
Tru9I TTAA 3 cut(s) 234, 426, 446
TscAI CASTG 1 cut(s) 55
TseI GCWGC 1 cut(s) 11
TspDTI ATGAA 4 cut(s) 81, 133, 220, 492
TspGWI ACGGA 2 cut(s) 49, 216
TspRI CASTG 1 cut(s) 55
XapI RAATTY 3 cut(s) 88, 304, 344
XceI RCATGY 2 cut(s) 274, 539
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.