MD08G1154700.v1.1

One of the components of the core complex of photosystem II (PSII). It binds chlorophyll and helps catalyze the primary light-induced photochemical processes of PSII. PSII is a light- driven water plastoquinone oxidoreductase, using light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Forward (+)
17189120 .. 17189371
252 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1154700.v1.1.491

Sequence Viewer

Length: 252 bp
ATGATGAAATCAAATTCTTGTGTTACCAAAATATGTTCTAAATTATATATTTTTATCTTGTGGACCGGGAATGCCCGACTTATCAATTTATCCGGTAAACTACTTGGGGCTTATGTAGCCCATGCTGAATTAATCATATTATGGACCGGAGCAATGAACCTATTTGAAGTGGCTCATTTCGTACCAAAGAAGCCTATGTATGAACAAGGATTAACTTTACTTCCTCACCTAGCTACTCTAGGTTGGGGGTAG

Protein Analysis

84

Amino Acids

9.25

Weight (kDa)

9.34

Isoelectric Point (pI)

13.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PSII PF00421 20 - 83 6.7e-23 Photosystem II protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 13
AfaI GTAC 1 cut(s) 183
AgsI TTSAA 1 cut(s) 167
AluBI AGCT 1 cut(s) 233
AluI AGCT 1 cut(s) 233
ApoI RAATTY 1 cut(s) 13
AseI ATTAAT 1 cut(s) 131
AspS9I GGNCC 2 cut(s) 63, 144
AsuC2I CCSGG 1 cut(s) 67
AsuHPI GGTGA 1 cut(s) 218
AvaII GGWCC 2 cut(s) 63, 144
BcnI CCSGG 1 cut(s) 67
BfaI CTAG 2 cut(s) 230, 239
Bme1390I CCNGG 1 cut(s) 67
Bme18I GGWCC 2 cut(s) 63, 144
BmgT120I GGNCC 2 cut(s) 63, 144
BmrFI CCNGG 1 cut(s) 67
BpuMI CCSGG 1 cut(s) 67
BsaWI WCCGGW 2 cut(s) 92, 146
Bse3DI GCAATG 1 cut(s) 159
BseMI GCAATG 1 cut(s) 159
BsiSI CCGG 3 cut(s) 66, 93, 147
BsmI GAATGC 1 cut(s) 76
BsrDI GCAATG 1 cut(s) 159
BstMWI GCNNNNNNNGC 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 65
Cfr13I GGNCC 2 cut(s) 63, 144
Csp6I GTAC 1 cut(s) 182
CviAII CATG 1 cut(s) 122
CviJI RGCY 5 cut(s) 110, 119, 173, 193, 233
CviKI_1 RGCY 5 cut(s) 110, 119, 173, 193, 233
CviQI GTAC 1 cut(s) 182
Eco47I GGWCC 2 cut(s) 63, 144
FaeI CATG 1 cut(s) 125
FaiI YATR 9 cut(s) 34, 46, 48, 114, 123, 137, 142, 197, 201
FatI CATG 1 cut(s) 121
FspBI CTAG 2 cut(s) 230, 239
HapII CCGG 3 cut(s) 66, 93, 147
Hin1II CATG 1 cut(s) 125
HpaII CCGG 3 cut(s) 66, 93, 147
HphI GGTGA 1 cut(s) 218
Hpy166II GTNNAC 2 cut(s) 63, 98
Hpy8I GTNNAC 2 cut(s) 63, 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 116
Hsp92II CATG 1 cut(s) 125
LmnI GCTCC 1 cut(s) 149
LpnPI CCDG 3 cut(s) 79, 106, 160
MaeI CTAG 2 cut(s) 230, 239
MaeIII GTNAC 1 cut(s) 22
MluCI AATT 4 cut(s) 13, 41, 85, 128
MnlI CCTC 1 cut(s) 234
MseI TTAA 2 cut(s) 131, 212
MspI CCGG 3 cut(s) 66, 93, 147
MspR9I CCNGG 1 cut(s) 67
Mva1269I GAATGC 1 cut(s) 76
MwoI GCNNNNNNNGC 1 cut(s) 116
NciI CCSGG 1 cut(s) 67
NlaIII CATG 1 cut(s) 125
PctI GAATGC 1 cut(s) 76
PshBI ATTAAT 1 cut(s) 131
PspPI GGNCC 2 cut(s) 63, 144
RsaI GTAC 1 cut(s) 183
RsaNI GTAC 1 cut(s) 182
SaqAI TTAA 2 cut(s) 131, 212
Sau96I GGNCC 2 cut(s) 63, 144
ScrFI CCNGG 1 cut(s) 67
SetI ASST 4 cut(s) 162, 231, 235, 244
SinI GGWCC 2 cut(s) 63, 144
Sse9I AATT 4 cut(s) 13, 41, 85, 128
SspMI CTAG 2 cut(s) 230, 239
StyD4I CCNGG 1 cut(s) 65
TasI AATT 4 cut(s) 13, 41, 85, 128
Tru1I TTAA 2 cut(s) 131, 212
Tru9I TTAA 2 cut(s) 131, 212
TspDTI ATGAA 3 cut(s) 20, 170, 216
VpaK11BI GGWCC 2 cut(s) 63, 144
VspI ATTAAT 1 cut(s) 131
XapI RAATTY 1 cut(s) 13
XspI CTAG 2 cut(s) 230, 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.