Rmu_sc0009742.1_g000009

Photosystem II (PSII) is a light-driven water plastoquinone oxidoreductase that uses light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation. It consists of a core antenna complex that captures photons, and an electron transfer chain that converts photonic excitation into a charge separation. The D1 D2 (PsbA PsbA) reaction center heterodimer binds P680, the primary electron donor of PSII as well as several subsequent electron acceptors. D2 is needed for assembly of a stable PSII complex

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009742.1
Physical Location & Seq
Forward (+)
44737 .. 45060
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009742.1_g000009.1.cds

Sequence Viewer

Length: 324 bp
atgggacctgaagcgcaaggggattttactcgttggtgtcaatcaggcggtctgtggacttttgccgctctacatggtgctttcagactaataggtttcatgttacgtcaatttgaactcgcacgatctgttcaattgcgacctattgactcgtgcgatctgttcaattgcgaccttataatgcaattgatcaaagagcagattttggagagattcttcatcgatgtagtggctggtgattcacaagagcgagcagccgccaggtttcattctttggtgggatacacagatgtagtggctggtgaaattggcaacctttggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

12.08

Weight (kDa)

4.97

Isoelectric Point (pI)

47.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 179
AccBSI CCGCTC 1 cut(s) 68
AciI CCGC 3 cut(s) 48, 66, 258
AcuI CTGAAG 1 cut(s) 30
AgsI TTSAA 3 cut(s) 116, 134, 166
AjnI CCWGG 1 cut(s) 260
ApeKI GCWGC 1 cut(s) 254
AspLEI GCGC 1 cut(s) 16
AspS9I GGNCC 1 cut(s) 5
AsuHPI GGTGA 2 cut(s) 248, 314
AvaII GGWCC 1 cut(s) 5
BauI CACGAG 1 cut(s) 151
BbvI GCAGC 1 cut(s) 266
BciT130I CCWGG 1 cut(s) 262
BciVI GTATCC 1 cut(s) 275
BclI TGATCA 1 cut(s) 189
BfuI GTATCC 1 cut(s) 275
BisI GCNGC 3 cut(s) 66, 255, 258
BlsI GCNGC 3 cut(s) 67, 256, 259
Bme1390I CCNGG 1 cut(s) 262
Bme18I GGWCC 1 cut(s) 5
BmgT120I GGNCC 1 cut(s) 5
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 262
Bsa29I ATCGAT 1 cut(s) 222
BseBI CCWGG 1 cut(s) 262
BseCI ATCGAT 1 cut(s) 222
BseXI GCAGC 1 cut(s) 266
BshVI ATCGAT 1 cut(s) 222
BslFI GGGAC 1 cut(s) 18
BsmFI GGGAC 1 cut(s) 18
Bsp143I GATC 3 cut(s) 125, 157, 189
BspACI CCGC 3 cut(s) 48, 66, 258
BspDI ATCGAT 1 cut(s) 222
BspLI GGNNCC 1 cut(s) 6
BsrBI CCGCTC 1 cut(s) 68
BssMI GATC 3 cut(s) 125, 157, 189
BssSI CACGAG 1 cut(s) 151
Bst2BI CACGAG 1 cut(s) 151
Bst2UI CCWGG 1 cut(s) 262
BstC8I GCNNGC 1 cut(s) 252
BstHHI GCGC 1 cut(s) 16
BstKTI GATC 3 cut(s) 128, 160, 192
BstMBI GATC 3 cut(s) 125, 157, 189
BstNI CCWGG 1 cut(s) 262
BstSCI CCNGG 1 cut(s) 260
BstV1I GCAGC 1 cut(s) 266
Bsu15I ATCGAT 1 cut(s) 222
BsuI GTATCC 1 cut(s) 275
BsuTUI ATCGAT 1 cut(s) 222
Cac8I GCNNGC 1 cut(s) 252
CfoI GCGC 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 5
ClaI ATCGAT 1 cut(s) 222
CviAII CATG 2 cut(s) 74, 100
CviJI RGCY 3 cut(s) 233, 257, 299
CviKI_1 RGCY 3 cut(s) 233, 257, 299
DpnI GATC 3 cut(s) 127, 159, 191
DpnII GATC 3 cut(s) 125, 157, 189
Eco47I GGWCC 1 cut(s) 5
Eco57I CTGAAG 1 cut(s) 30
EcoO109I RGGNCCY 1 cut(s) 5
EcoRII CCWGG 1 cut(s) 260
FaeI CATG 2 cut(s) 77, 103
FaiI YATR 3 cut(s) 75, 101, 179
FaqI GGGAC 1 cut(s) 18
FatI CATG 2 cut(s) 73, 99
FbaI TGATCA 1 cut(s) 189
Fnu4HI GCNGC 3 cut(s) 66, 255, 258
Fsp4HI GCNGC 3 cut(s) 66, 255, 258
GlaI GCGC 1 cut(s) 15
GluI GCNGC 3 cut(s) 66, 255, 258
HhaI GCGC 1 cut(s) 16
Hin1II CATG 2 cut(s) 77, 103
Hin6I GCGC 1 cut(s) 14
HinP1I GCGC 1 cut(s) 14
HinfI GANTC 3 cut(s) 149, 213, 239
HphI GGTGA 2 cut(s) 248, 314
Hpy166II GTNNAC 1 cut(s) 57
Hpy188I TCNGA 1 cut(s) 86
Hpy8I GTNNAC 1 cut(s) 57
HpyCH4IV ACGT 1 cut(s) 106
HpyCH4V TGCA 1 cut(s) 184
HpySE526I ACGT 1 cut(s) 106
Hsp92II CATG 2 cut(s) 77, 103
HspAI GCGC 1 cut(s) 14
Ksp22I TGATCA 1 cut(s) 189
Kzo9I GATC 3 cut(s) 125, 157, 189
LpnPI CCDG 6 cut(s) 21, 30, 219, 247, 274, 285
Lsp1109I GCAGC 1 cut(s) 266
MaeII ACGT 1 cut(s) 106
MaeIII GTNAC 1 cut(s) 102
MalI GATC 3 cut(s) 127, 159, 191
MbiI CCGCTC 1 cut(s) 68
MboI GATC 3 cut(s) 125, 157, 189
MboII GAAGA 1 cut(s) 208
MfeI CAATTG 3 cut(s) 134, 166, 185
MluCI AATT 5 cut(s) 110, 134, 166, 185, 306
MlyI GAGTC 1 cut(s) 143
MspR9I CCNGG 1 cut(s) 262
MunI CAATTG 3 cut(s) 134, 166, 185
MvaI CCWGG 1 cut(s) 262
NdeII GATC 3 cut(s) 125, 157, 189
NlaIII CATG 2 cut(s) 77, 103
NlaIV GGNNCC 1 cut(s) 6
PfeI GAWTC 2 cut(s) 213, 239
PkrI GCNGC 3 cut(s) 67, 256, 259
PleI GAGTC 1 cut(s) 143
PpsI GAGTC 1 cut(s) 143
PpuMI RGGWCCY 1 cut(s) 5
PsiI TTATAA 1 cut(s) 179
Psp5II RGGWCCY 1 cut(s) 5
Psp6I CCWGG 1 cut(s) 260
PspGI CCWGG 1 cut(s) 260
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 5
PspPPI RGGWCCY 1 cut(s) 5
SatI GCNGC 3 cut(s) 66, 255, 258
Sau3AI GATC 3 cut(s) 125, 157, 189
Sau96I GGNCC 1 cut(s) 5
SchI GAGTC 1 cut(s) 143
ScrFI CCNGG 1 cut(s) 262
SetI ASST 7 cut(s) 10, 97, 109, 145, 177, 266, 318
SinI GGWCC 1 cut(s) 5
Sse9I AATT 5 cut(s) 110, 134, 166, 185, 306
SsiI CCGC 3 cut(s) 48, 66, 258
StyD4I CCNGG 1 cut(s) 260
TaiI ACGT 1 cut(s) 109
TaqI TCGA 1 cut(s) 222
TasI AATT 5 cut(s) 110, 134, 166, 185, 306
TauI GCSGC 2 cut(s) 68, 260
TfiI GAWTC 2 cut(s) 213, 239
TseI GCWGC 1 cut(s) 254
TspDTI ATGAA 3 cut(s) 88, 208, 257
VpaK11BI GGWCC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.