MD09G1030500.v1.1
MYB Family

Myb-related protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Forward (+)
1868876 .. 1869081
206 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1030500.v1.1.491

Sequence Viewer

Length: 150 bp
ATGGATAAAAATCCATTCAATAGTTCATCCCAGGATGTTGAAGTGAGAAAAGGGCCATGGACCATGGAAGAAGATTTGATTCTCATCAACTATATTGCAAATCATGGTGAAGGTGTATGGAACTCCCTAGCCAAAGCTGCTGGTAATTAA

Protein Analysis

50

Amino Acids

5.45

Weight (kDa)

4.7

Isoelectric Point (pI)

33.39

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 17 - 48 1.1e-08 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 19, 41
AjnI CCWGG 1 cut(s) 30
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
AoxI GGCC 1 cut(s) 53
ApeKI GCWGC 1 cut(s) 137
AspS9I GGNCC 2 cut(s) 53, 60
AsuHPI GGTGA 1 cut(s) 119
AvaII GGWCC 1 cut(s) 60
BbvI GCAGC 1 cut(s) 124
BciT130I CCWGG 1 cut(s) 32
BfaI CTAG 1 cut(s) 128
BisI GCNGC 1 cut(s) 138
BlsI GCNGC 1 cut(s) 139
Bme1390I CCNGG 1 cut(s) 32
Bme18I GGWCC 1 cut(s) 60
BmgT120I GGNCC 2 cut(s) 53, 60
BmrFI CCNGG 1 cut(s) 32
BsaBI GATNNNNATC 2 cut(s) 9, 83
BsaJI CCNNGG 3 cut(s) 30, 56, 63
Bse8I GATNNNNATC 2 cut(s) 9, 83
BseBI CCWGG 1 cut(s) 32
BseDI CCNNGG 3 cut(s) 30, 56, 63
BseGI GGATG 2 cut(s) 26, 40
BseJI GATNNNNATC 2 cut(s) 9, 83
BseXI GCAGC 1 cut(s) 124
BshFI GGCC 1 cut(s) 55
BsnI GGCC 1 cut(s) 55
Bsp19I CCATGG 2 cut(s) 56, 63
BspANI GGCC 1 cut(s) 55
BssECI CCNNGG 3 cut(s) 30, 56, 63
BssT1I CCWWGG 2 cut(s) 56, 63
Bst2UI CCWGG 1 cut(s) 32
BstDSI CCRYGG 2 cut(s) 56, 63
BstF5I GGATG 2 cut(s) 26, 40
BstMWI GCNNNNNNNGC 1 cut(s) 137
BstNI CCWGG 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 30
BstV1I GCAGC 1 cut(s) 124
BsuRI GGCC 1 cut(s) 55
BtgI CCRYGG 2 cut(s) 56, 63
BtsCI GGATG 2 cut(s) 26, 40
Cfr13I GGNCC 2 cut(s) 53, 60
CviAII CATG 3 cut(s) 57, 64, 104
CviJI RGCY 3 cut(s) 55, 131, 137
CviKI_1 RGCY 3 cut(s) 55, 131, 137
Eco130I CCWWGG 2 cut(s) 56, 63
Eco47I GGWCC 1 cut(s) 60
EcoRII CCWGG 1 cut(s) 30
EcoT14I CCWWGG 2 cut(s) 56, 63
ErhI CCWWGG 2 cut(s) 56, 63
FaeI CATG 3 cut(s) 60, 67, 107
FaiI YATR 5 cut(s) 58, 65, 93, 105, 118
FatI CATG 3 cut(s) 56, 63, 103
Fnu4HI GCNGC 1 cut(s) 138
FokI GGATG 2 cut(s) 13, 47
Fsp4HI GCNGC 1 cut(s) 138
FspBI CTAG 1 cut(s) 128
GluI GCNGC 1 cut(s) 138
HaeIII GGCC 1 cut(s) 55
Hin1II CATG 3 cut(s) 60, 67, 107
HinfI GANTC 1 cut(s) 79
HphI GGTGA 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 104
HpyCH4V TGCA 1 cut(s) 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 137
Hsp92II CATG 3 cut(s) 60, 67, 107
LpnPI CCDG 3 cut(s) 17, 44, 126
Lsp1109I GCAGC 1 cut(s) 124
MaeI CTAG 1 cut(s) 128
MboII GAAGA 2 cut(s) 80, 83
MluCI AATT 1 cut(s) 145
MseI TTAA 1 cut(s) 148
MspR9I CCNGG 1 cut(s) 32
MvaI CCWGG 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 137
NcoI CCATGG 2 cut(s) 56, 63
NlaIII CATG 3 cut(s) 60, 67, 107
PfeI GAWTC 1 cut(s) 79
PkrI GCNGC 1 cut(s) 139
Psp6I CCWGG 1 cut(s) 30
PspGI CCWGG 1 cut(s) 30
PspPI GGNCC 2 cut(s) 53, 60
SaqAI TTAA 1 cut(s) 148
SatI GCNGC 1 cut(s) 138
Sau96I GGNCC 2 cut(s) 53, 60
ScrFI CCNGG 1 cut(s) 32
SetI ASST 2 cut(s) 115, 139
SgeI CNNG 6 cut(s) 43, 44, 69, 76, 116, 140
SinI GGWCC 1 cut(s) 60
Sse9I AATT 1 cut(s) 145
SspMI CTAG 1 cut(s) 128
StyD4I CCNGG 1 cut(s) 30
StyI CCWWGG 2 cut(s) 56, 63
TasI AATT 1 cut(s) 145
TfiI GAWTC 1 cut(s) 79
Tru1I TTAA 1 cut(s) 148
Tru9I TTAA 1 cut(s) 148
TseI GCWGC 1 cut(s) 137
TspDTI ATGAA 1 cut(s) 15
VpaK11BI GGWCC 1 cut(s) 60
XspI CTAG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.