MD09G1089100.v1.1

Auxin responsive protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Forward (+)
6500577 .. 6500903
327 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1089100.v1.1.491

Sequence Viewer

Length: 327 bp
ATGAAGAGAGTGCTTTGCTATTTGCTAATGGGGGTGAGAAGAAGCAGTAAATTAAGCCAGTTAATAGGAGCAAAAAGACTGAAAAGTTCTCATTCTACAACACCGAAACGTTACGTGCCTGTTTGTGTTGGTGTGGATGGTGATACTAAGCGTTTCATGATTCATTCCAAGTTGCTTCGTCATGTAGAGTTCTTGAAACTGCTATATAGATCAGCTGAGGAATATGGGTTTTGCAATGATGGGGTTTTGAGGATTCCATACGAAGCCAGGGATTTTGAAGAGTTGTTCGTGGCTAGAATTTCCGTTGGGATGTTTCCTAGCAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.5

Weight (kDa)

9.96

Isoelectric Point (pI)

47.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 20 - 95 2.3e-15 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 109
AcsI RAATTY 1 cut(s) 297
AgsI TTSAA 2 cut(s) 196, 278
AjnI CCWGG 1 cut(s) 266
AluBI AGCT 1 cut(s) 215
AluI AGCT 1 cut(s) 215
ApoI RAATTY 1 cut(s) 297
AsuHPI GGTGA 2 cut(s) 46, 152
BbvCI CCTCAGC 1 cut(s) 216
BccI CCATC 2 cut(s) 131, 233
BciT130I CCWGG 1 cut(s) 268
BfaI CTAG 2 cut(s) 294, 318
Bme1390I CCNGG 1 cut(s) 268
BmrFI CCNGG 1 cut(s) 268
Bpu10I CCTNAGC 1 cut(s) 216
BsaAI YACGTR 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 267
Bse1I ACTGG 1 cut(s) 58
Bse3DI GCAATG 1 cut(s) 241
BseBI CCWGG 1 cut(s) 268
BseDI CCNNGG 1 cut(s) 267
BseGI GGATG 2 cut(s) 142, 315
BseMI GCAATG 1 cut(s) 241
BseMII CTCAG 1 cut(s) 207
BseNI ACTGG 1 cut(s) 58
Bsp143I GATC 1 cut(s) 209
BspCNI CTCAG 1 cut(s) 208
BspHI TCATGA 1 cut(s) 156
BsrDI GCAATG 1 cut(s) 241
BsrI ACTGG 1 cut(s) 58
BssECI CCNNGG 1 cut(s) 267
BssMI GATC 1 cut(s) 209
Bst2UI CCWGG 1 cut(s) 268
Bst6I CTCTTC 1 cut(s) 273
BstBAI YACGTR 1 cut(s) 115
BstDEI CTNAG 2 cut(s) 147, 216
BstF5I GGATG 2 cut(s) 142, 315
BstKTI GATC 1 cut(s) 212
BstMBI GATC 1 cut(s) 209
BstNI CCWGG 1 cut(s) 268
BstSCI CCNGG 1 cut(s) 266
BtsCI GGATG 2 cut(s) 142, 315
CciI TCATGA 1 cut(s) 156
CviAII CATG 2 cut(s) 157, 182
CviJI RGCY 4 cut(s) 57, 215, 266, 293
CviKI_1 RGCY 4 cut(s) 57, 215, 266, 293
DdeI CTNAG 2 cut(s) 147, 216
DpnI GATC 1 cut(s) 211
DpnII GATC 1 cut(s) 209
Eam1104I CTCTTC 1 cut(s) 273
EarI CTCTTC 1 cut(s) 273
EcoRII CCWGG 1 cut(s) 266
FaeI CATG 2 cut(s) 160, 185
FaiI YATR 6 cut(s) 158, 183, 205, 207, 225, 259
FatI CATG 2 cut(s) 156, 181
FokI GGATG 2 cut(s) 149, 322
FspBI CTAG 2 cut(s) 294, 318
Hin1II CATG 2 cut(s) 160, 185
HinfI GANTC 2 cut(s) 160, 253
HphI GGTGA 2 cut(s) 46, 152
Hpy188III TCNNGA 2 cut(s) 157, 193
HpyCH4IV ACGT 2 cut(s) 109, 114
HpyCH4V TGCA 1 cut(s) 234
HpyF3I CTNAG 2 cut(s) 147, 216
HpySE526I ACGT 2 cut(s) 109, 114
Hsp92II CATG 2 cut(s) 160, 185
Kzo9I GATC 1 cut(s) 209
LmnI GCTCC 1 cut(s) 68
LpnPI CCDG 4 cut(s) 71, 132, 253, 280
MaeI CTAG 2 cut(s) 294, 318
MaeII ACGT 2 cut(s) 109, 114
MaeIII GTNAC 1 cut(s) 110
MalI GATC 1 cut(s) 211
MboI GATC 1 cut(s) 209
MboII GAAGA 3 cut(s) 16, 51, 290
MluCI AATT 2 cut(s) 50, 297
MnlI CCTC 2 cut(s) 211, 243
MseI TTAA 2 cut(s) 53, 62
MspA1I CMGCKG 1 cut(s) 215
MspR9I CCNGG 1 cut(s) 268
MvaI CCWGG 1 cut(s) 268
NdeII GATC 1 cut(s) 209
NlaIII CATG 2 cut(s) 160, 185
PagI TCATGA 1 cut(s) 156
PfeI GAWTC 2 cut(s) 160, 253
Ppu21I YACGTR 1 cut(s) 115
Psp1406I AACGTT 1 cut(s) 109
Psp6I CCWGG 1 cut(s) 266
PspGI CCWGG 1 cut(s) 266
PvuII CAGCTG 1 cut(s) 215
SaqAI TTAA 2 cut(s) 53, 62
Sau3AI GATC 1 cut(s) 209
ScrFI CCNGG 1 cut(s) 268
SetI ASST 3 cut(s) 112, 117, 217
Sse9I AATT 2 cut(s) 50, 297
SspMI CTAG 2 cut(s) 294, 318
StyD4I CCNGG 1 cut(s) 266
TaiI ACGT 2 cut(s) 112, 117
TasI AATT 2 cut(s) 50, 297
TfiI GAWTC 2 cut(s) 160, 253
Tru1I TTAA 2 cut(s) 53, 62
Tru9I TTAA 2 cut(s) 53, 62
TspDTI ATGAA 3 cut(s) 17, 145, 152
TspGWI ACGGA 1 cut(s) 292
XapI RAATTY 1 cut(s) 297
XspI CTAG 2 cut(s) 294, 318
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.