MD11G1176000.v1.1

La-related protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
20805034 .. 20806321
1288 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1176000.v1.1.491

Sequence Viewer

Length: 228 bp
ATGTTGTTGAGGGACAATATTATAAAGCAAATAGAGTATTATTTCAGTGATGAAAATCTAAAGAAAGACCGTTACTTAATTTCATTGATGGATGACCAAGGATGGGTCCCAATAACCACCATTGCTGACTTTAAAAGGGTATGTTTTGGTATCATAGTAGATATTGCAGAAGCTAAGGTAATACATGCTGATCCAGTTTTTCTTTTGGTCAGCTGTGTGATCTATTAG

Protein Analysis

76

Amino Acids

8.74

Weight (kDa)

4.83

Isoelectric Point (pI)

28.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
La PF05383 7 - 47 5.5e-21 La domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 23
AclWI GGATC 1 cut(s) 185
AfiI CCNNNNNNNGG 1 cut(s) 103
AluBI AGCT 2 cut(s) 173, 213
AluI AGCT 2 cut(s) 173, 213
AlwI GGATC 1 cut(s) 185
AspS9I GGNCC 1 cut(s) 106
AvaII GGWCC 1 cut(s) 106
BccI CCATC 2 cut(s) 82, 96
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmiI GGNNCC 2 cut(s) 107, 108
Bpu10I CCTNAGC 1 cut(s) 174
BsaBI GATNNNNATC 1 cut(s) 54
BsaJI CCNNGG 1 cut(s) 97
Bsc4I CCNNNNNNNGG 1 cut(s) 103
Bse1I ACTGG 1 cut(s) 194
Bse3DI GCAATG 1 cut(s) 120
Bse8I GATNNNNATC 1 cut(s) 54
BseDI CCNNGG 1 cut(s) 97
BseGI GGATG 2 cut(s) 97, 107
BseJI GATNNNNATC 1 cut(s) 54
BseLI CCNNNNNNNGG 1 cut(s) 103
BseMI GCAATG 1 cut(s) 120
BseNI ACTGG 1 cut(s) 194
BslFI GGGAC 2 cut(s) 26, 92
BslI CCNNNNNNNGG 1 cut(s) 103
BsmFI GGGAC 2 cut(s) 26, 92
Bsp143I GATC 2 cut(s) 190, 219
BspLI GGNNCC 2 cut(s) 107, 108
BspPI GGATC 1 cut(s) 185
BsrDI GCAATG 1 cut(s) 120
BsrI ACTGG 1 cut(s) 194
BssECI CCNNGG 1 cut(s) 97
BssMI GATC 2 cut(s) 190, 219
BssT1I CCWWGG 1 cut(s) 97
Bst4CI ACNGT 1 cut(s) 71
BstDEI CTNAG 1 cut(s) 174
BstF5I GGATG 2 cut(s) 97, 107
BstKTI GATC 2 cut(s) 193, 222
BstMBI GATC 2 cut(s) 190, 219
BstNSI RCATGY 1 cut(s) 188
BtsCI GGATG 2 cut(s) 97, 107
BtsIMutI CAGTG 1 cut(s) 52
Cfr13I GGNCC 1 cut(s) 106
CviAII CATG 1 cut(s) 185
CviJI RGCY 2 cut(s) 173, 213
CviKI_1 RGCY 2 cut(s) 173, 213
DdeI CTNAG 1 cut(s) 174
DpnI GATC 2 cut(s) 192, 221
DpnII GATC 2 cut(s) 190, 219
DraI TTTAAA 1 cut(s) 133
Eco130I CCWWGG 1 cut(s) 97
Eco47I GGWCC 1 cut(s) 106
EcoO109I RGGNCCY 1 cut(s) 106
EcoT14I CCWWGG 1 cut(s) 97
ErhI CCWWGG 1 cut(s) 97
FaeI CATG 1 cut(s) 188
FaiI YATR 4 cut(s) 23, 142, 155, 186
FaqI GGGAC 2 cut(s) 26, 92
FatI CATG 1 cut(s) 184
FokI GGATG 2 cut(s) 104, 114
Hin1II CATG 1 cut(s) 188
HpyCH4III ACNGT 1 cut(s) 71
HpyCH4V TGCA 1 cut(s) 167
HpyF3I CTNAG 1 cut(s) 174
Hsp92II CATG 1 cut(s) 188
KflI GGGWCCC 1 cut(s) 106
Kzo9I GATC 2 cut(s) 190, 219
LpnPI CCDG 1 cut(s) 207
MaeIII GTNAC 1 cut(s) 71
MalI GATC 2 cut(s) 192, 221
MboI GATC 2 cut(s) 190, 219
MluCI AATT 1 cut(s) 78
MnlI CCTC 1 cut(s) 3
MseI TTAA 2 cut(s) 77, 132
MspA1I CMGCKG 1 cut(s) 213
NdeII GATC 2 cut(s) 190, 219
NlaIII CATG 1 cut(s) 188
NlaIV GGNNCC 2 cut(s) 107, 108
NspI RCATGY 1 cut(s) 188
PpuMI RGGWCCY 1 cut(s) 106
PsiI TTATAA 1 cut(s) 23
Psp5II RGGWCCY 1 cut(s) 106
PspN4I GGNNCC 2 cut(s) 107, 108
PspPI GGNCC 1 cut(s) 106
PspPPI RGGWCCY 1 cut(s) 106
PvuII CAGCTG 1 cut(s) 213
SaqAI TTAA 2 cut(s) 77, 132
Sau3AI GATC 2 cut(s) 190, 219
Sau96I GGNCC 1 cut(s) 106
SetI ASST 3 cut(s) 175, 180, 215
SgeI CNNG 3 cut(s) 110, 197, 206
SinI GGWCC 1 cut(s) 106
Sse9I AATT 1 cut(s) 78
SspI AATATT 1 cut(s) 19
StyI CCWWGG 1 cut(s) 97
TaaI ACNGT 1 cut(s) 71
TasI AATT 1 cut(s) 78
Tru1I TTAA 2 cut(s) 77, 132
Tru9I TTAA 2 cut(s) 77, 132
TscAI CASTG 1 cut(s) 52
TspDTI ATGAA 2 cut(s) 66, 72
TspRI CASTG 1 cut(s) 52
VpaK11BI GGWCC 1 cut(s) 106
XceI RCATGY 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.