MD12G1208200.v1.1

Ppx/GppA phosphatase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0003859
Physical Location & Seq
Reverse (-)
28776000 .. 28777361
1362 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1208200.v1.1.491

Sequence Viewer

Length: 474 bp
ATGGCTTATTTTGGAAGCTGCTGTGAGAATAAGCTGAAAATCAAAGGAAAAGCTGAAGCTGCTATTTCCGCTTATTCTCACAGCAGCTTTTTTTCAAAGCACAGCAATACCAAGGATCTTGAATATCTTGAAGCTGCATGTGTGCTCCACAATATTGGGATTTCCGTCGGCAAAAAGGGTTACCATAAGCATTCTAGTTCTATCATAACGAAGGGCAATCATCTTCATGGTTATAGTACTGAGGAGGTCAAGCTGATAGCACTACTTGCAAAACACCACAGGAAGAACTTACCAAACTTTGACCATGTATCCTTCAAGGAGTTTCCAGAACAGGTAGCATTTTATCTGAATATATACAATTATTTGTGCTTTTATGTTTATTTTTGCGTTCTTTCTCTTTTCTGTCAGGTCAAAAAGAAATTCAGGTTTCTATGTGCAATTATCTGTACATCTGCTGCACTACAACAACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HD Ppx-GppA

Protein Analysis

158

Amino Acids

17.91

Weight (kDa)

9.15

Isoelectric Point (pI)

34.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ppx-GppA_III PF21447 22 - 111 1.8e-14 Ppx/GppA phosphatase, domain III
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 69
AclWI GGATC 1 cut(s) 123
AcsI RAATTY 1 cut(s) 419
AcuI CTGAAG 1 cut(s) 75
AfaI GTAC 2 cut(s) 238, 448
AgsI TTSAA 4 cut(s) 96, 122, 131, 316
AluBI AGCT 7 cut(s) 18, 34, 53, 59, 87, 134, 253
AluI AGCT 7 cut(s) 18, 34, 53, 59, 87, 134, 253
Alw21I GWGCWC 1 cut(s) 147
AlwI GGATC 1 cut(s) 123
ApeKI GCWGC 5 cut(s) 18, 59, 84, 134, 455
ApoI RAATTY 1 cut(s) 419
Bbv12I GWGCWC 1 cut(s) 147
BbvI GCAGC 5 cut(s) 5, 46, 96, 121, 442
BciVI GTATCC 1 cut(s) 319
BfaI CTAG 1 cut(s) 195
BfuI GTATCC 1 cut(s) 319
BisI GCNGC 5 cut(s) 19, 60, 85, 135, 456
BlsI GCNGC 5 cut(s) 20, 61, 86, 136, 457
BmcAI AGTACT 1 cut(s) 238
BsaJI CCNNGG 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 111
BseMII CTCAG 1 cut(s) 231
BseRI GAGGAG 1 cut(s) 257
BseXI GCAGC 5 cut(s) 5, 46, 96, 121, 442
BsgI GTGCAG 1 cut(s) 441
BsiHKAI GWGCWC 1 cut(s) 147
BsmI GAATGC 1 cut(s) 190
Bsp1286I GDGCHC 1 cut(s) 147
Bsp1407I TGTACA 1 cut(s) 446
Bsp143I GATC 1 cut(s) 115
BspACI CCGC 1 cut(s) 69
BspCNI CTCAG 1 cut(s) 232
BspPI GGATC 1 cut(s) 123
BsrGI TGTACA 1 cut(s) 446
BssECI CCNNGG 1 cut(s) 111
BssMI GATC 1 cut(s) 115
BssT1I CCWWGG 1 cut(s) 111
BstAPI GCANNNNNTGC 1 cut(s) 266
BstAUI TGTACA 1 cut(s) 446
BstDEI CTNAG 1 cut(s) 240
BstEII GGTNACC 1 cut(s) 179
BstKTI GATC 1 cut(s) 118
BstMBI GATC 1 cut(s) 115
BstMWI GCNNNNNNNGC 3 cut(s) 59, 68, 266
BstNSI RCATGY 1 cut(s) 141
BstPI GGTNACC 1 cut(s) 179
BstV1I GCAGC 5 cut(s) 5, 46, 96, 121, 442
BstX2I RGATCY 1 cut(s) 115
BstXI CCANNNNNNTGG 1 cut(s) 155
BstYI RGATCY 1 cut(s) 115
BsuI GTATCC 1 cut(s) 319
Csp6I GTAC 2 cut(s) 237, 447
CviAII CATG 3 cut(s) 138, 227, 305
CviJI RGCY 8 cut(s) 5, 18, 34, 53, 59, 87, 134, 253
CviKI_1 RGCY 8 cut(s) 5, 18, 34, 53, 59, 87, 134, 253
CviQI GTAC 2 cut(s) 237, 447
DdeI CTNAG 1 cut(s) 240
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
Eco130I CCWWGG 1 cut(s) 111
Eco57I CTGAAG 1 cut(s) 75
Eco91I GGTNACC 1 cut(s) 179
EcoO65I GGTNACC 1 cut(s) 179
EcoT14I CCWWGG 1 cut(s) 111
ErhI CCWWGG 1 cut(s) 111
FaeI CATG 3 cut(s) 141, 230, 308
FatI CATG 3 cut(s) 137, 226, 304
Fnu4HI GCNGC 5 cut(s) 19, 60, 85, 135, 456
Fsp4HI GCNGC 5 cut(s) 19, 60, 85, 135, 456
FspBI CTAG 1 cut(s) 195
GluI GCNGC 5 cut(s) 19, 60, 85, 135, 456
Hin1II CATG 3 cut(s) 141, 230, 308
Hpy188I TCNGA 1 cut(s) 348
Hpy188III TCNNGA 3 cut(s) 119, 128, 326
Hpy99I CGWCG 1 cut(s) 170
HpyAV CCTTC 2 cut(s) 205, 322
HpyCH4V TGCA 4 cut(s) 137, 269, 437, 458
HpyF10VI GCNNNNNNNGC 3 cut(s) 59, 68, 266
HpyF3I CTNAG 1 cut(s) 240
Hsp92II CATG 3 cut(s) 141, 230, 308
Kzo9I GATC 1 cut(s) 115
LmnI GCTCC 1 cut(s) 150
LpnPI CCDG 5 cut(s) 265, 317, 339, 392, 409
Lsp1109I GCAGC 5 cut(s) 5, 46, 96, 121, 442
MaeI CTAG 1 cut(s) 195
MaeIII GTNAC 1 cut(s) 179
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MboII GAAGA 2 cut(s) 215, 295
MflI RGATCY 1 cut(s) 115
MhlI GDGCHC 1 cut(s) 147
MluCI AATT 3 cut(s) 358, 419, 438
MnlI CCTC 2 cut(s) 235, 238
MslI CAYNNNNRTG 1 cut(s) 225
Mva1269I GAATGC 1 cut(s) 190
MwoI GCNNNNNNNGC 3 cut(s) 59, 68, 266
NdeII GATC 1 cut(s) 115
NlaIII CATG 3 cut(s) 141, 230, 308
NspI RCATGY 1 cut(s) 141
PctI GAATGC 1 cut(s) 190
PkrI GCNGC 5 cut(s) 20, 61, 86, 136, 457
PspEI GGTNACC 1 cut(s) 179
PsuI RGATCY 1 cut(s) 115
RsaI GTAC 2 cut(s) 238, 448
RsaNI GTAC 2 cut(s) 237, 447
RseI CAYNNNNRTG 1 cut(s) 225
SatI GCNGC 5 cut(s) 19, 60, 85, 135, 456
Sau3AI GATC 1 cut(s) 115
ScaI AGTACT 1 cut(s) 238
SduI GDGCHC 1 cut(s) 147
SmiMI CAYNNNNRTG 1 cut(s) 225
Sse9I AATT 3 cut(s) 358, 419, 438
SsiI CCGC 1 cut(s) 69
SspI AATATT 1 cut(s) 154
SspMI CTAG 1 cut(s) 195
StyI CCWWGG 1 cut(s) 111
TasI AATT 3 cut(s) 358, 419, 438
TatI WGTACW 2 cut(s) 236, 446
TseI GCWGC 5 cut(s) 18, 59, 84, 134, 455
TspDTI ATGAA 1 cut(s) 215
TspGWI ACGGA 1 cut(s) 154
XapI RAATTY 1 cut(s) 419
XceI RCATGY 1 cut(s) 141
XspI CTAG 1 cut(s) 195
ZrmI AGTACT 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.