MD14G1010200.v1.1

ubiquitin-protein transferase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0012658
Physical Location & Seq
Forward (+)
981214 .. 982433
1220 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1010200.v1.1.491

Sequence Viewer

Length: 351 bp
ATGATTTTTCTTGCTATTCACCAACTCTTAGCCTCTTCCTCTTCTTCCTCCTCCTATTTGATCAAAATGCTTCAAAATCCATCTCTTAGACTACTTCTGGTACTCTCATTGGTTTTCTCGTATGATCTATCTTCATCTGCAGTTCCTGCAACCAGGAGCCTCAGGTCAGAGGAGAAAGACTTGTCGGTCCAAGAATCTCTGGGTCTAGTGGATGTGGGGAGAGGAGACGAGGTGTTTGATGCGGGCGAGGGAGAGAGTTTTATTGAAGGAAGGATGGCTATAGAAAGTGAAGACTATCCAGGAACAGGAGCAAACAACCATCATGACCCAAGAACCCCTGGAAAAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

117

Amino Acids

12.51

Weight (kDa)

4.76

Isoelectric Point (pI)

64.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 185
AciI CCGC 1 cut(s) 242
AfaI GTAC 1 cut(s) 102
AfiI CCNNNNNNNGG 1 cut(s) 305
AgsI TTSAA 2 cut(s) 74, 266
AjnI CCWGG 3 cut(s) 152, 298, 337
AluBI AGCT 1 cut(s) 347
AluI AGCT 1 cut(s) 347
Alw26I GTCTC 1 cut(s) 219
AlwNI CAGNNNCTG 1 cut(s) 146
ArsI GACNNNNNNTTYG 2 cut(s) 218, 250
AspS9I GGNCC 1 cut(s) 187
AsuHPI GGTGA 1 cut(s) 11
AvaII GGWCC 1 cut(s) 187
AxyI CCTNAGG 1 cut(s) 161
BbsI GAAGAC 1 cut(s) 297
BccI CCATC 3 cut(s) 88, 268, 327
BciT130I CCWGG 3 cut(s) 154, 300, 339
BclI TGATCA 1 cut(s) 60
BcoDI GTCTC 1 cut(s) 219
BfaI CTAG 1 cut(s) 206
BfmI CTRYAG 2 cut(s) 138, 279
Bme1390I CCNGG 3 cut(s) 154, 300, 339
Bme18I GGWCC 1 cut(s) 187
BmgT120I GGNCC 1 cut(s) 187
BmiI GGNNCC 1 cut(s) 158
BmrFI CCNGG 3 cut(s) 154, 300, 339
BmsI GCATC 1 cut(s) 229
BpiI GAAGAC 1 cut(s) 297
BsaJI CCNNGG 1 cut(s) 337
BsaXI ACNNNNNCTCC 2 cut(s) 216, 246
Bsc4I CCNNNNNNNGG 1 cut(s) 305
Bse21I CCTNAGG 1 cut(s) 161
BseBI CCWGG 3 cut(s) 154, 300, 339
BseDI CCNNGG 1 cut(s) 337
BseGI GGATG 2 cut(s) 217, 279
BseLI CCNNNNNNNGG 1 cut(s) 305
BseMII CTCAG 1 cut(s) 175
BseRI GAGGAG 3 cut(s) 40, 185, 237
BslI CCNNNNNNNGG 1 cut(s) 305
BsmAI GTCTC 1 cut(s) 219
BsmBI CGTCTC 1 cut(s) 219
Bsp143I GATC 2 cut(s) 60, 124
BspACI CCGC 1 cut(s) 242
BspCNI CTCAG 1 cut(s) 174
BspHI TCATGA 1 cut(s) 322
BspLI GGNNCC 1 cut(s) 158
BspMAI CTGCAG 1 cut(s) 142
BssECI CCNNGG 1 cut(s) 337
BssMI GATC 2 cut(s) 60, 124
Bst2UI CCWGG 3 cut(s) 154, 300, 339
Bst6I CTCTTC 2 cut(s) 40, 46
BstAPI GCANNNNNTGC 1 cut(s) 146
BstC8I GCNNGC 1 cut(s) 244
BstDEI CTNAG 3 cut(s) 28, 86, 161
BstF5I GGATG 2 cut(s) 217, 279
BstKTI GATC 2 cut(s) 63, 127
BstMAI GTCTC 1 cut(s) 219
BstMBI GATC 2 cut(s) 60, 124
BstMWI GCNNNNNNNGC 1 cut(s) 146
BstNI CCWGG 3 cut(s) 154, 300, 339
BstSCI CCNGG 3 cut(s) 152, 298, 337
BstSFI CTRYAG 2 cut(s) 138, 279
BstV2I GAAGAC 1 cut(s) 297
Bsu36I CCTNAGG 1 cut(s) 161
BtsCI GGATG 2 cut(s) 217, 279
Cac8I GCNNGC 1 cut(s) 244
CaiI CAGNNNCTG 1 cut(s) 146
CciI TCATGA 1 cut(s) 322
Cfr13I GGNCC 1 cut(s) 187
Csp6I GTAC 1 cut(s) 101
CviAII CATG 1 cut(s) 323
CviJI RGCY 4 cut(s) 32, 159, 278, 347
CviKI_1 RGCY 4 cut(s) 32, 159, 278, 347
CviQI GTAC 1 cut(s) 101
DdeI CTNAG 3 cut(s) 28, 86, 161
DpnI GATC 2 cut(s) 62, 126
DpnII GATC 2 cut(s) 60, 124
DrdI GACNNNNNNGTC 1 cut(s) 185
DseDI GACNNNNNNGTC 1 cut(s) 185
Eam1104I CTCTTC 2 cut(s) 40, 46
EarI CTCTTC 2 cut(s) 40, 46
Eco47I GGWCC 1 cut(s) 187
Eco81I CCTNAGG 1 cut(s) 161
EcoRII CCWGG 3 cut(s) 152, 298, 337
Esp3I CGTCTC 1 cut(s) 219
FaeI CATG 1 cut(s) 326
FaiI YATR 3 cut(s) 123, 281, 324
FatI CATG 1 cut(s) 322
FauI CCCGC 1 cut(s) 235
FbaI TGATCA 1 cut(s) 60
FokI GGATG 2 cut(s) 224, 286
FspBI CTAG 1 cut(s) 206
Hin1II CATG 1 cut(s) 326
HindIII AAGCTT 1 cut(s) 345
HinfI GANTC 1 cut(s) 194
HphI GGTGA 1 cut(s) 11
Hpy188I TCNGA 1 cut(s) 169
Hpy188III TCNNGA 1 cut(s) 323
HpyAV CCTTC 2 cut(s) 260, 264
HpyCH4V TGCA 2 cut(s) 140, 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpyF3I CTNAG 3 cut(s) 28, 86, 161
Hsp92II CATG 1 cut(s) 326
Ksp22I TGATCA 1 cut(s) 60
Kzo9I GATC 2 cut(s) 60, 124
LmnI GCTCC 2 cut(s) 156, 308
LweI GCATC 1 cut(s) 229
MaeI CTAG 1 cut(s) 206
MalI GATC 2 cut(s) 62, 126
MboI GATC 2 cut(s) 60, 124
MboII GAAGA 5 cut(s) 27, 33, 36, 123, 302
MnlI CCTC 9 cut(s) 43, 49, 58, 61, 163, 170, 215, 223, 241
MseI TTAA 1 cut(s) 349
MspR9I CCNGG 3 cut(s) 154, 300, 339
MvaI CCWGG 3 cut(s) 154, 300, 339
MwoI GCNNNNNNNGC 1 cut(s) 146
NdeII GATC 2 cut(s) 60, 124
NlaIII CATG 1 cut(s) 326
NlaIV GGNNCC 1 cut(s) 158
PagI TCATGA 1 cut(s) 322
PfeI GAWTC 1 cut(s) 194
PfoI TCCNGGA 1 cut(s) 298
Psp6I CCWGG 3 cut(s) 152, 298, 337
PspGI CCWGG 3 cut(s) 152, 298, 337
PspN4I GGNNCC 1 cut(s) 158
PspPI GGNCC 1 cut(s) 187
PstI CTGCAG 1 cut(s) 142
PstNI CAGNNNCTG 1 cut(s) 146
RsaI GTAC 1 cut(s) 102
RsaNI GTAC 1 cut(s) 101
SaqAI TTAA 1 cut(s) 349
Sau3AI GATC 2 cut(s) 60, 124
Sau96I GGNCC 1 cut(s) 187
ScrFI CCNGG 3 cut(s) 154, 300, 339
SetI ASST 3 cut(s) 167, 234, 349
SfaNI GCATC 1 cut(s) 229
SfcI CTRYAG 2 cut(s) 138, 279
SinI GGWCC 1 cut(s) 187
SsiI CCGC 1 cut(s) 242
SspMI CTAG 1 cut(s) 206
StyD4I CCNGG 3 cut(s) 152, 298, 337
TaqII GACCGA 1 cut(s) 175
TfiI GAWTC 1 cut(s) 194
Tru1I TTAA 1 cut(s) 349
Tru9I TTAA 1 cut(s) 349
TspDTI ATGAA 1 cut(s) 123
VpaK11BI GGWCC 1 cut(s) 187
XspI CTAG 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.