Rh3BG361800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
43959430 .. 43960405
976 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG361800.1

Sequence Viewer

Length: 198 bp
ATGACCGGGGTTATAGGAAGCATCAACATAAATAAGGATGATCTACTAGATCACCAGAATTATTTAATTGATGAAGTGCGTCAACTTGCTTTGGGAACTGAAGTTATGGACAGGAGGATTGGTTTGGAAACCATGGACTACTCAGAAGTAGGACCAAACCCAGGACATGATCCAACTAAACCACCAGGAAGAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.2

Weight (kDa)

4.64

Isoelectric Point (pI)

33.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 164
AcuI CTGAAG 1 cut(s) 120
AfiI CCNNNNNNNGG 1 cut(s) 161
AjnI CCWGG 2 cut(s) 160, 184
AlwI GGATC 1 cut(s) 164
AspS9I GGNCC 1 cut(s) 152
AsuC2I CCSGG 1 cut(s) 7
AsuHPI GGTGA 1 cut(s) 44
AvaII GGWCC 1 cut(s) 152
BciT130I CCWGG 2 cut(s) 162, 186
BcnI CCSGG 1 cut(s) 7
BfaI CTAG 1 cut(s) 47
Bme1390I CCNGG 3 cut(s) 7, 162, 186
Bme18I GGWCC 1 cut(s) 152
BmgT120I GGNCC 1 cut(s) 152
BmrFI CCNGG 3 cut(s) 7, 162, 186
BmsI GCATC 1 cut(s) 30
BpuMI CCSGG 1 cut(s) 7
BsaJI CCNNGG 3 cut(s) 6, 132, 160
BsaXI ACNNNNNCTCC 2 cut(s) 106, 136
Bsc4I CCNNNNNNNGG 1 cut(s) 161
BseBI CCWGG 2 cut(s) 162, 186
BseDI CCNNGG 3 cut(s) 6, 132, 160
BseGI GGATG 1 cut(s) 43
BseLI CCNNNNNNNGG 1 cut(s) 161
BseMII CTCAG 1 cut(s) 156
BsiSI CCGG 1 cut(s) 6
BslI CCNNNNNNNGG 1 cut(s) 161
Bsp143I GATC 3 cut(s) 40, 49, 169
Bsp19I CCATGG 1 cut(s) 132
BspCNI CTCAG 1 cut(s) 155
BspPI GGATC 1 cut(s) 164
BssECI CCNNGG 3 cut(s) 6, 132, 160
BssMI GATC 3 cut(s) 40, 49, 169
BssT1I CCWWGG 1 cut(s) 132
Bst2UI CCWGG 2 cut(s) 162, 186
Bst6I CTCTTC 1 cut(s) 184
BstDEI CTNAG 1 cut(s) 142
BstDSI CCRYGG 1 cut(s) 132
BstF5I GGATG 1 cut(s) 43
BstKTI GATC 3 cut(s) 43, 52, 172
BstMBI GATC 3 cut(s) 40, 49, 169
BstNI CCWGG 2 cut(s) 162, 186
BstSCI CCNGG 3 cut(s) 5, 160, 184
BtgI CCRYGG 1 cut(s) 132
BtsCI GGATG 1 cut(s) 43
Cfr13I GGNCC 1 cut(s) 152
CseI GACGC 1 cut(s) 68
CviAII CATG 2 cut(s) 133, 167
DdeI CTNAG 1 cut(s) 142
DpnI GATC 3 cut(s) 42, 51, 171
DpnII GATC 3 cut(s) 40, 49, 169
Eam1104I CTCTTC 1 cut(s) 184
EarI CTCTTC 1 cut(s) 184
Eco130I CCWWGG 1 cut(s) 132
Eco47I GGWCC 1 cut(s) 152
Eco57I CTGAAG 1 cut(s) 120
EcoRII CCWGG 2 cut(s) 160, 184
EcoT14I CCWWGG 1 cut(s) 132
ErhI CCWWGG 1 cut(s) 132
FaeI CATG 2 cut(s) 136, 170
FaiI YATR 5 cut(s) 14, 29, 107, 134, 168
FatI CATG 2 cut(s) 132, 166
FokI GGATG 1 cut(s) 50
FspBI CTAG 1 cut(s) 47
HapII CCGG 1 cut(s) 6
HgaI GACGC 1 cut(s) 68
Hin1II CATG 2 cut(s) 136, 170
HincII GTYRAC 1 cut(s) 83
HindII GTYRAC 1 cut(s) 83
HpaII CCGG 1 cut(s) 6
HphI GGTGA 1 cut(s) 44
Hpy166II GTNNAC 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 145
Hpy8I GTNNAC 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 142
Hsp92II CATG 2 cut(s) 136, 170
Kzo9I GATC 3 cut(s) 40, 49, 169
LpnPI CCDG 6 cut(s) 19, 68, 97, 147, 171, 174
LweI GCATC 1 cut(s) 30
MaeI CTAG 1 cut(s) 47
MalI GATC 3 cut(s) 42, 51, 171
MboI GATC 3 cut(s) 40, 49, 169
MluCI AATT 2 cut(s) 58, 66
MmeI TCCRAC 1 cut(s) 197
MnlI CCTC 1 cut(s) 108
MseI TTAA 1 cut(s) 65
MspI CCGG 1 cut(s) 6
MspR9I CCNGG 3 cut(s) 7, 162, 186
MvaI CCWGG 2 cut(s) 162, 186
NciI CCSGG 1 cut(s) 7
NcoI CCATGG 1 cut(s) 132
NdeII GATC 3 cut(s) 40, 49, 169
NlaIII CATG 2 cut(s) 136, 170
Psp6I CCWGG 2 cut(s) 160, 184
PspGI CCWGG 2 cut(s) 160, 184
PspPI GGNCC 1 cut(s) 152
SaqAI TTAA 1 cut(s) 65
Sau3AI GATC 3 cut(s) 40, 49, 169
Sau96I GGNCC 1 cut(s) 152
ScrFI CCNGG 3 cut(s) 7, 162, 186
SfaNI GCATC 1 cut(s) 30
SinI GGWCC 1 cut(s) 152
Sse9I AATT 2 cut(s) 58, 66
SspMI CTAG 1 cut(s) 47
StyD4I CCNGG 3 cut(s) 5, 160, 184
StyI CCWWGG 1 cut(s) 132
TasI AATT 2 cut(s) 58, 66
Tru1I TTAA 1 cut(s) 65
Tru9I TTAA 1 cut(s) 65
TspDTI ATGAA 1 cut(s) 87
VpaK11BI GGWCC 1 cut(s) 152
XspI CTAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.