RLG00000022576

ubiquitin-protein transferase activity

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
Physical Location & Seq
Reverse (-)
4281213 .. 4281708
496 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000022576

Sequence Viewer

Length: 309 bp
ATGGTGATTGACCAGAAGTCTAATCTTATGCTACAACTAGTTCTTCTTTTGAGTTTCACATATGTCCTCTTATCTGCTTCAGCTCCAACAACGAGAAGCATCAACATAAATAAAGATGATCTACAAGATCTTTTTTTTTTGGTCAATGATGATCTACAAGATCACCAGAATTATTTAATGGATGAAGTGCGTCATGTTGCTTTGGGAACTGAAGTTATTGACAGGAGGATTGGTTTGGAAACCATGGACTACTCAGAAGTAGGACCAAACCCAGGACATGATCCAACTAAACCACCAGGAAGAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

11.52

Weight (kDa)

4.6

Isoelectric Point (pI)

45.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 275
AcuI CTGAAG 2 cut(s) 63, 231
AfiI CCNNNNNNNGG 1 cut(s) 272
AhdI GACNNNNNGTC 1 cut(s) 16
AhlI ACTAGT 1 cut(s) 37
AjnI CCWGG 2 cut(s) 271, 295
AluBI AGCT 1 cut(s) 83
AluI AGCT 1 cut(s) 83
AlwI GGATC 1 cut(s) 275
AspS9I GGNCC 1 cut(s) 263
AsuHPI GGTGA 2 cut(s) 16, 155
AvaII GGWCC 1 cut(s) 263
BciT130I CCWGG 2 cut(s) 273, 297
BcuI ACTAGT 1 cut(s) 37
BfaI CTAG 1 cut(s) 38
BglII AGATCT 1 cut(s) 127
Bme1390I CCNGG 2 cut(s) 273, 297
Bme18I GGWCC 1 cut(s) 263
BmeRI GACNNNNNGTC 1 cut(s) 16
BmgT120I GGNCC 1 cut(s) 263
BmrFI CCNGG 2 cut(s) 273, 297
BmsI GCATC 1 cut(s) 108
BsaJI CCNNGG 2 cut(s) 243, 271
BsaXI ACNNNNNCTCC 2 cut(s) 217, 247
Bsc4I CCNNNNNNNGG 1 cut(s) 272
BseBI CCWGG 2 cut(s) 273, 297
BseDI CCNNGG 2 cut(s) 243, 271
BseGI GGATG 1 cut(s) 187
BseLI CCNNNNNNNGG 1 cut(s) 272
BseMII CTCAG 1 cut(s) 267
BslI CCNNNNNNNGG 1 cut(s) 272
Bsp143I GATC 5 cut(s) 118, 127, 151, 160, 280
Bsp19I CCATGG 1 cut(s) 243
BspCNI CTCAG 1 cut(s) 266
BspPI GGATC 1 cut(s) 275
BssECI CCNNGG 2 cut(s) 243, 271
BssMI GATC 5 cut(s) 118, 127, 151, 160, 280
BssT1I CCWWGG 1 cut(s) 243
Bst2UI CCWGG 2 cut(s) 273, 297
Bst6I CTCTTC 1 cut(s) 295
BstDEI CTNAG 1 cut(s) 253
BstDSI CCRYGG 1 cut(s) 243
BstF5I GGATG 1 cut(s) 187
BstKTI GATC 5 cut(s) 121, 130, 154, 163, 283
BstMBI GATC 5 cut(s) 118, 127, 151, 160, 280
BstNI CCWGG 2 cut(s) 273, 297
BstSCI CCNGG 2 cut(s) 271, 295
BstX2I RGATCY 1 cut(s) 127
BstYI RGATCY 1 cut(s) 127
BtgI CCRYGG 1 cut(s) 243
BtsCI GGATG 1 cut(s) 187
Cfr13I GGNCC 1 cut(s) 263
CseI GACGC 1 cut(s) 179
CviAII CATG 3 cut(s) 194, 244, 278
CviJI RGCY 1 cut(s) 83
CviKI_1 RGCY 1 cut(s) 83
DdeI CTNAG 1 cut(s) 253
DpnI GATC 5 cut(s) 120, 129, 153, 162, 282
DpnII GATC 5 cut(s) 118, 127, 151, 160, 280
DriI GACNNNNNGTC 1 cut(s) 16
Eam1104I CTCTTC 1 cut(s) 295
Eam1105I GACNNNNNGTC 1 cut(s) 16
EarI CTCTTC 1 cut(s) 295
Eco130I CCWWGG 1 cut(s) 243
Eco47I GGWCC 1 cut(s) 263
Eco57I CTGAAG 2 cut(s) 63, 231
EcoRII CCWGG 2 cut(s) 271, 295
EcoT14I CCWWGG 1 cut(s) 243
ErhI CCWWGG 1 cut(s) 243
FaeI CATG 3 cut(s) 197, 247, 281
FaiI YATR 7 cut(s) 29, 61, 63, 107, 195, 245, 279
FatI CATG 3 cut(s) 193, 243, 277
FauNDI CATATG 1 cut(s) 61
FokI GGATG 1 cut(s) 194
FspBI CTAG 1 cut(s) 38
HgaI GACGC 1 cut(s) 179
Hin1II CATG 3 cut(s) 197, 247, 281
HphI GGTGA 2 cut(s) 16, 155
Hpy188I TCNGA 1 cut(s) 256
HpyF3I CTNAG 1 cut(s) 253
Hsp92II CATG 3 cut(s) 197, 247, 281
Kzo9I GATC 5 cut(s) 118, 127, 151, 160, 280
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 6 cut(s) 26, 179, 208, 258, 282, 285
LweI GCATC 1 cut(s) 108
MaeI CTAG 1 cut(s) 38
MalI GATC 5 cut(s) 120, 129, 153, 162, 282
MboI GATC 5 cut(s) 118, 127, 151, 160, 280
MboII GAAGA 1 cut(s) 35
MflI RGATCY 1 cut(s) 127
MluCI AATT 1 cut(s) 169
MmeI TCCRAC 2 cut(s) 110, 308
MnlI CCTC 2 cut(s) 77, 219
MseI TTAA 1 cut(s) 176
MspR9I CCNGG 2 cut(s) 273, 297
MvaI CCWGG 2 cut(s) 273, 297
NcoI CCATGG 1 cut(s) 243
NdeI CATATG 1 cut(s) 61
NdeII GATC 5 cut(s) 118, 127, 151, 160, 280
NlaIII CATG 3 cut(s) 197, 247, 281
Psp6I CCWGG 2 cut(s) 271, 295
PspGI CCWGG 2 cut(s) 271, 295
PspPI GGNCC 1 cut(s) 263
PsuI RGATCY 1 cut(s) 127
SaqAI TTAA 1 cut(s) 176
Sau3AI GATC 5 cut(s) 118, 127, 151, 160, 280
Sau96I GGNCC 1 cut(s) 263
ScrFI CCNGG 2 cut(s) 273, 297
SetI ASST 1 cut(s) 85
SfaNI GCATC 1 cut(s) 108
SinI GGWCC 1 cut(s) 263
SpeI ACTAGT 1 cut(s) 37
Sse9I AATT 1 cut(s) 169
SspMI CTAG 1 cut(s) 38
StyD4I CCNGG 2 cut(s) 271, 295
StyI CCWWGG 1 cut(s) 243
TasI AATT 1 cut(s) 169
Tru1I TTAA 1 cut(s) 176
Tru9I TTAA 1 cut(s) 176
TspDTI ATGAA 1 cut(s) 198
VpaK11BI GGWCC 1 cut(s) 263
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.