Rroxscaffold_6G00389740

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
3793003 .. 3793302
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00389740.1

Sequence Viewer

Length: 210 bp
ATGGCCGGGGTTATAGGAAGCATCAACATAAATCAAGATGATCTACAAGATCACCAGAATTATTTAATGGATGAAGTGCGTCAACTTGCTTTGGGAACTGAAGTTATTGACAGGAGGATTGGTTTGGAAACCATGGACTACTCAGAAGTAGGACCAAACCCAGGACATGATCCAACACCAGGAAGAGTAAACCACCAGGACAAAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.66

Weight (kDa)

4.5

Isoelectric Point (pI)

41.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 164
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 120
AfiI CCNNNNNNNGG 2 cut(s) 161, 179
AjnI CCWGG 3 cut(s) 160, 178, 195
AluBI AGCT 1 cut(s) 206
AluI AGCT 1 cut(s) 206
AlwI GGATC 1 cut(s) 164
AoxI GGCC 1 cut(s) 3
AspS9I GGNCC 1 cut(s) 152
AsuC2I CCSGG 1 cut(s) 7
AsuHPI GGTGA 1 cut(s) 44
AvaII GGWCC 1 cut(s) 152
BciT130I CCWGG 3 cut(s) 162, 180, 197
BcnI CCSGG 1 cut(s) 7
Bme1390I CCNGG 4 cut(s) 7, 162, 180, 197
Bme18I GGWCC 1 cut(s) 152
BmgT120I GGNCC 1 cut(s) 152
BmrFI CCNGG 4 cut(s) 7, 162, 180, 197
BmsI GCATC 1 cut(s) 30
BpuMI CCSGG 1 cut(s) 7
BsaJI CCNNGG 3 cut(s) 6, 132, 160
BsaXI ACNNNNNCTCC 2 cut(s) 106, 136
Bsc4I CCNNNNNNNGG 2 cut(s) 161, 179
BseBI CCWGG 3 cut(s) 162, 180, 197
BseDI CCNNGG 3 cut(s) 6, 132, 160
BseGI GGATG 1 cut(s) 76
BseLI CCNNNNNNNGG 2 cut(s) 161, 179
BseMII CTCAG 1 cut(s) 156
BshFI GGCC 1 cut(s) 5
BsiSI CCGG 1 cut(s) 6
BslI CCNNNNNNNGG 2 cut(s) 161, 179
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 3 cut(s) 40, 49, 169
Bsp19I CCATGG 1 cut(s) 132
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 155
BspPI GGATC 1 cut(s) 164
BssECI CCNNGG 3 cut(s) 6, 132, 160
BssMI GATC 3 cut(s) 40, 49, 169
BssT1I CCWWGG 1 cut(s) 132
Bst2UI CCWGG 3 cut(s) 162, 180, 197
Bst6I CTCTTC 1 cut(s) 178
BstDEI CTNAG 1 cut(s) 142
BstDSI CCRYGG 1 cut(s) 132
BstF5I GGATG 1 cut(s) 76
BstKTI GATC 3 cut(s) 43, 52, 172
BstMBI GATC 3 cut(s) 40, 49, 169
BstNI CCWGG 3 cut(s) 162, 180, 197
BstSCI CCNGG 4 cut(s) 5, 160, 178, 195
BsuRI GGCC 1 cut(s) 5
BtgI CCRYGG 1 cut(s) 132
BtsCI GGATG 1 cut(s) 76
Cfr13I GGNCC 1 cut(s) 152
CseI GACGC 1 cut(s) 68
CviAII CATG 2 cut(s) 133, 167
CviJI RGCY 2 cut(s) 5, 206
CviKI_1 RGCY 2 cut(s) 5, 206
DdeI CTNAG 1 cut(s) 142
DpnI GATC 3 cut(s) 42, 51, 171
DpnII GATC 3 cut(s) 40, 49, 169
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 178
EarI CTCTTC 1 cut(s) 178
Eco130I CCWWGG 1 cut(s) 132
Eco47I GGWCC 1 cut(s) 152
Eco57I CTGAAG 1 cut(s) 120
EcoRII CCWGG 3 cut(s) 160, 178, 195
EcoT14I CCWWGG 1 cut(s) 132
ErhI CCWWGG 1 cut(s) 132
FaeI CATG 2 cut(s) 136, 170
FaiI YATR 4 cut(s) 14, 29, 134, 168
FatI CATG 2 cut(s) 132, 166
FokI GGATG 1 cut(s) 83
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 6
HgaI GACGC 1 cut(s) 68
Hin1II CATG 2 cut(s) 136, 170
HincII GTYRAC 1 cut(s) 83
HindII GTYRAC 1 cut(s) 83
HindIII AAGCTT 1 cut(s) 204
HpaII CCGG 1 cut(s) 6
HphI GGTGA 1 cut(s) 44
Hpy166II GTNNAC 2 cut(s) 83, 190
Hpy188I TCNGA 1 cut(s) 145
Hpy188III TCNNGA 1 cut(s) 35
Hpy8I GTNNAC 2 cut(s) 83, 190
HpyF3I CTNAG 1 cut(s) 142
Hsp92II CATG 2 cut(s) 136, 170
Kzo9I GATC 3 cut(s) 40, 49, 169
LpnPI CCDG 8 cut(s) 19, 68, 97, 147, 165, 174, 182, 192
LweI GCATC 1 cut(s) 30
MalI GATC 3 cut(s) 42, 51, 171
MboI GATC 3 cut(s) 40, 49, 169
MboII GAAGA 1 cut(s) 195
MluCI AATT 1 cut(s) 58
MmeI TCCRAC 1 cut(s) 197
MnlI CCTC 1 cut(s) 108
MseI TTAA 2 cut(s) 65, 208
MspI CCGG 1 cut(s) 6
MspR9I CCNGG 4 cut(s) 7, 162, 180, 197
MvaI CCWGG 3 cut(s) 162, 180, 197
NciI CCSGG 1 cut(s) 7
NcoI CCATGG 1 cut(s) 132
NdeII GATC 3 cut(s) 40, 49, 169
NlaIII CATG 2 cut(s) 136, 170
Psp6I CCWGG 3 cut(s) 160, 178, 195
PspGI CCWGG 3 cut(s) 160, 178, 195
PspPI GGNCC 1 cut(s) 152
SaqAI TTAA 2 cut(s) 65, 208
Sau3AI GATC 3 cut(s) 40, 49, 169
Sau96I GGNCC 1 cut(s) 152
ScrFI CCNGG 4 cut(s) 7, 162, 180, 197
SetI ASST 1 cut(s) 208
SfaNI GCATC 1 cut(s) 30
SinI GGWCC 1 cut(s) 152
Sse9I AATT 1 cut(s) 58
StyD4I CCNGG 4 cut(s) 5, 160, 178, 195
StyI CCWWGG 1 cut(s) 132
TasI AATT 1 cut(s) 58
Tru1I TTAA 2 cut(s) 65, 208
Tru9I TTAA 2 cut(s) 65, 208
TspDTI ATGAA 1 cut(s) 87
VpaK11BI GGWCC 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.