Rh3AG325300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
46039886 .. 46041041
1156 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG325300.1

Sequence Viewer

Length: 276 bp
ATGGTGATTGACCAGAAATCTAATCTTATGCTACAACTAGTTCTTCTTTTGAGTTTCACATATCTCCTCTTATCTGCTTCAGCTTCAACAACGAGAAGCATCAACATAAATAAAGATGATCTACAAGATCACCAGAATTATTTAATGGATGAAGTGCGTCAAGTTGCTTTGGGAACTGAAGTTATTGACAGGAGGATTGGTTTGGAAACCATGGACTACTCAGAAGTAGGACCAAACCCAGGACATGATCCAACTAAACCACCAGGAAGAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.2

Weight (kDa)

4.88

Isoelectric Point (pI)

41.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 242
AcuI CTGAAG 2 cut(s) 63, 198
AfiI CCNNNNNNNGG 1 cut(s) 239
AgsI TTSAA 1 cut(s) 87
AhlI ACTAGT 1 cut(s) 37
AjnI CCWGG 2 cut(s) 238, 262
AluBI AGCT 1 cut(s) 83
AluI AGCT 1 cut(s) 83
AlwI GGATC 1 cut(s) 242
AspS9I GGNCC 1 cut(s) 230
AsuHPI GGTGA 2 cut(s) 16, 122
AvaII GGWCC 1 cut(s) 230
BciT130I CCWGG 2 cut(s) 240, 264
BcuI ACTAGT 1 cut(s) 37
BfaI CTAG 1 cut(s) 38
Bme1390I CCNGG 2 cut(s) 240, 264
Bme18I GGWCC 1 cut(s) 230
BmgT120I GGNCC 1 cut(s) 230
BmrFI CCNGG 2 cut(s) 240, 264
BmsI GCATC 1 cut(s) 108
BsaJI CCNNGG 2 cut(s) 210, 238
BsaXI ACNNNNNCTCC 2 cut(s) 184, 214
Bsc4I CCNNNNNNNGG 1 cut(s) 239
BseBI CCWGG 2 cut(s) 240, 264
BseDI CCNNGG 2 cut(s) 210, 238
BseGI GGATG 1 cut(s) 154
BseLI CCNNNNNNNGG 1 cut(s) 239
BseMII CTCAG 1 cut(s) 234
BseRI GAGGAG 1 cut(s) 56
BslI CCNNNNNNNGG 1 cut(s) 239
Bsp143I GATC 3 cut(s) 118, 127, 247
Bsp19I CCATGG 1 cut(s) 210
BspCNI CTCAG 1 cut(s) 233
BspPI GGATC 1 cut(s) 242
BssECI CCNNGG 2 cut(s) 210, 238
BssMI GATC 3 cut(s) 118, 127, 247
BssT1I CCWWGG 1 cut(s) 210
Bst2UI CCWGG 2 cut(s) 240, 264
Bst6I CTCTTC 1 cut(s) 262
BstDEI CTNAG 1 cut(s) 220
BstDSI CCRYGG 1 cut(s) 210
BstF5I GGATG 1 cut(s) 154
BstKTI GATC 3 cut(s) 121, 130, 250
BstMBI GATC 3 cut(s) 118, 127, 247
BstNI CCWGG 2 cut(s) 240, 264
BstSCI CCNGG 2 cut(s) 238, 262
BtgI CCRYGG 1 cut(s) 210
BtsCI GGATG 1 cut(s) 154
Cfr13I GGNCC 1 cut(s) 230
CseI GACGC 1 cut(s) 146
CviAII CATG 2 cut(s) 211, 245
CviJI RGCY 1 cut(s) 83
CviKI_1 RGCY 1 cut(s) 83
DdeI CTNAG 1 cut(s) 220
DpnI GATC 3 cut(s) 120, 129, 249
DpnII GATC 3 cut(s) 118, 127, 247
Eam1104I CTCTTC 1 cut(s) 262
EarI CTCTTC 1 cut(s) 262
Eco130I CCWWGG 1 cut(s) 210
Eco47I GGWCC 1 cut(s) 230
Eco57I CTGAAG 2 cut(s) 63, 198
EcoRII CCWGG 2 cut(s) 238, 262
EcoT14I CCWWGG 1 cut(s) 210
ErhI CCWWGG 1 cut(s) 210
FaeI CATG 2 cut(s) 214, 248
FaiI YATR 5 cut(s) 29, 61, 107, 212, 246
FatI CATG 2 cut(s) 210, 244
FokI GGATG 1 cut(s) 161
FspBI CTAG 1 cut(s) 38
HgaI GACGC 1 cut(s) 146
Hin1II CATG 2 cut(s) 214, 248
HphI GGTGA 2 cut(s) 16, 122
Hpy188I TCNGA 1 cut(s) 223
HpyF3I CTNAG 1 cut(s) 220
Hsp92II CATG 2 cut(s) 214, 248
Kzo9I GATC 3 cut(s) 118, 127, 247
LpnPI CCDG 6 cut(s) 26, 146, 175, 225, 249, 252
LweI GCATC 1 cut(s) 108
MaeI CTAG 1 cut(s) 38
MalI GATC 3 cut(s) 120, 129, 249
MboI GATC 3 cut(s) 118, 127, 247
MboII GAAGA 1 cut(s) 35
MluCI AATT 1 cut(s) 136
MmeI TCCRAC 1 cut(s) 275
MnlI CCTC 2 cut(s) 77, 186
MseI TTAA 1 cut(s) 143
MspR9I CCNGG 2 cut(s) 240, 264
MvaI CCWGG 2 cut(s) 240, 264
NcoI CCATGG 1 cut(s) 210
NdeII GATC 3 cut(s) 118, 127, 247
NlaIII CATG 2 cut(s) 214, 248
Psp6I CCWGG 2 cut(s) 238, 262
PspGI CCWGG 2 cut(s) 238, 262
PspPI GGNCC 1 cut(s) 230
SaqAI TTAA 1 cut(s) 143
Sau3AI GATC 3 cut(s) 118, 127, 247
Sau96I GGNCC 1 cut(s) 230
ScrFI CCNGG 2 cut(s) 240, 264
SetI ASST 1 cut(s) 85
SfaNI GCATC 1 cut(s) 108
SinI GGWCC 1 cut(s) 230
SpeI ACTAGT 1 cut(s) 37
Sse9I AATT 1 cut(s) 136
SspMI CTAG 1 cut(s) 38
StyD4I CCNGG 2 cut(s) 238, 262
StyI CCWWGG 1 cut(s) 210
TasI AATT 1 cut(s) 136
Tru1I TTAA 1 cut(s) 143
Tru9I TTAA 1 cut(s) 143
TspDTI ATGAA 1 cut(s) 165
VpaK11BI GGWCC 1 cut(s) 230
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.