Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr3D

Orthogroup ID

OG0012658

Physical Location & Seq

Genomic Coordinates Forward (+)

44636004 .. 44636977

Gene Structure 974 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh3DG361100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 258 bp

ATGCAATTTTATGACTCCCTTTTATTACCAAGAACACATAATCTATTTTTTTTTTCTTTTATGGCCGGGGTTATAGGAAGCATCAACATAAATAAAGATGATCTACAAGATCACCAGAATTATTTAATGGATGAAGTGCGTCAACTTGCTTTCGGAACTGAAGTTATTGACAGGAGGATTGGTTTGGAAACCATGGACTACTCAGAAGTAGGACCAAACCCAGGACATGATCCAACTAAACCACCAGGAAGAGTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

85

Amino Acids

9.73

Weight (kDa)

4.86

Isoelectric Point (pI)

48.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012658)

Species	Orthologous Gene IDs
malus_domestica	MD12G1012300.v1.1 MD12G1012400.v1.1 MD14G1010100.v1.1 MD14G1010200.v1.1
prunus_persica	Prupe.7G016200_v2.0.a1 Prupe.7G016300_v2.0.a1
pyrus_communis	pycom12g00970 pycom12g00980 pycom14g00850 pycom14g00860
rosa_chinensis	RchiOBHm_Chr3g0495961
rosa_laevigata	RLG00000022576
rosa_roxburghii	Rroxscaffold_6G00389740
rosa_rugosa	Rorug03G0278000
rosa_samantha	Rh3AG325300 Rh3BG361800 Rh3CG357800 Rh3DG361100
rosa_wichuraiana	Rw3G028440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	224
AcoI	YGGCCR	1 cut(s)	63
AcuI	CTGAAG	1 cut(s)	180
AfiI	CCNNNNNNNGG	1 cut(s)	221
AjnI	CCWGG	2 cut(s)	220, 244
AlwI	GGATC	1 cut(s)	224
AoxI	GGCC	1 cut(s)	63
AspS9I	GGNCC	1 cut(s)	212
AsuC2I	CCSGG	1 cut(s)	67
AsuHPI	GGTGA	1 cut(s)	104
AvaII	GGWCC	1 cut(s)	212
BciT130I	CCWGG	2 cut(s)	222, 246
BcnI	CCSGG	1 cut(s)	67
Bme1390I	CCNGG	3 cut(s)	67, 222, 246
Bme18I	GGWCC	1 cut(s)	212
BmgT120I	GGNCC	1 cut(s)	212
BmrFI	CCNGG	3 cut(s)	67, 222, 246
BmsI	GCATC	1 cut(s)	90
BpuMI	CCSGG	1 cut(s)	67
BsaJI	CCNNGG	3 cut(s)	66, 192, 220
BsaXI	ACNNNNNCTCC	2 cut(s)	166, 196
Bsc4I	CCNNNNNNNGG	1 cut(s)	221
BseBI	CCWGG	2 cut(s)	222, 246
BseDI	CCNNGG	3 cut(s)	66, 192, 220
BseGI	GGATG	1 cut(s)	136
BseLI	CCNNNNNNNGG	1 cut(s)	221
BseMII	CTCAG	1 cut(s)	216
BshFI	GGCC	1 cut(s)	65
BsiSI	CCGG	1 cut(s)	66
BslI	CCNNNNNNNGG	1 cut(s)	221
BsnI	GGCC	1 cut(s)	65
Bsp143I	GATC	3 cut(s)	100, 109, 229
Bsp19I	CCATGG	1 cut(s)	192
BspANI	GGCC	1 cut(s)	65
BspCNI	CTCAG	1 cut(s)	215
BspPI	GGATC	1 cut(s)	224
BssECI	CCNNGG	3 cut(s)	66, 192, 220
BssMI	GATC	3 cut(s)	100, 109, 229
BssT1I	CCWWGG	1 cut(s)	192
Bst2UI	CCWGG	2 cut(s)	222, 246
Bst6I	CTCTTC	1 cut(s)	244
BstDEI	CTNAG	1 cut(s)	202
BstDSI	CCRYGG	1 cut(s)	192
BstF5I	GGATG	1 cut(s)	136
BstKTI	GATC	3 cut(s)	103, 112, 232
BstMBI	GATC	3 cut(s)	100, 109, 229
BstNI	CCWGG	2 cut(s)	222, 246
BstSCI	CCNGG	3 cut(s)	65, 220, 244
BsuRI	GGCC	1 cut(s)	65
BtgI	CCRYGG	1 cut(s)	192
BtsCI	GGATG	1 cut(s)	136
Cfr13I	GGNCC	1 cut(s)	212
CseI	GACGC	1 cut(s)	128
CviAII	CATG	2 cut(s)	193, 227
CviJI	RGCY	1 cut(s)	65
CviKI_1	RGCY	1 cut(s)	65
DdeI	CTNAG	1 cut(s)	202
DpnI	GATC	3 cut(s)	102, 111, 231
DpnII	GATC	3 cut(s)	100, 109, 229
EaeI	YGGCCR	1 cut(s)	63
Eam1104I	CTCTTC	1 cut(s)	244
EarI	CTCTTC	1 cut(s)	244
Eco130I	CCWWGG	1 cut(s)	192
Eco47I	GGWCC	1 cut(s)	212
Eco57I	CTGAAG	1 cut(s)	180
EcoRII	CCWGG	2 cut(s)	220, 244
EcoT14I	CCWWGG	1 cut(s)	192
ErhI	CCWWGG	1 cut(s)	192
FaeI	CATG	2 cut(s)	196, 230
FaiI	YATR	7 cut(s)	12, 39, 62, 74, 89, 194, 228
FatI	CATG	2 cut(s)	192, 226
FokI	GGATG	1 cut(s)	143
HaeIII	GGCC	1 cut(s)	65
HapII	CCGG	1 cut(s)	66
HgaI	GACGC	1 cut(s)	128
Hin1II	CATG	2 cut(s)	196, 230
HincII	GTYRAC	1 cut(s)	143
HindII	GTYRAC	1 cut(s)	143
HinfI	GANTC	1 cut(s)	14
HpaII	CCGG	1 cut(s)	66
HphI	GGTGA	1 cut(s)	104
Hpy166II	GTNNAC	1 cut(s)	143
Hpy188I	TCNGA	2 cut(s)	155, 205
Hpy8I	GTNNAC	1 cut(s)	143
HpyCH4V	TGCA	1 cut(s)	4
HpyF3I	CTNAG	1 cut(s)	202
Hsp92II	CATG	2 cut(s)	196, 230
Kzo9I	GATC	3 cut(s)	100, 109, 229
LpnPI	CCDG	6 cut(s)	79, 128, 157, 207, 231, 234
LweI	GCATC	1 cut(s)	90
MalI	GATC	3 cut(s)	102, 111, 231
MboI	GATC	3 cut(s)	100, 109, 229
MluCI	AATT	2 cut(s)	5, 118
MlyI	GAGTC	1 cut(s)	8
MmeI	TCCRAC	1 cut(s)	257
MnlI	CCTC	1 cut(s)	168
MseI	TTAA	1 cut(s)	125
MspI	CCGG	1 cut(s)	66
MspR9I	CCNGG	3 cut(s)	67, 222, 246
MvaI	CCWGG	2 cut(s)	222, 246
NciI	CCSGG	1 cut(s)	67
NcoI	CCATGG	1 cut(s)	192
NdeII	GATC	3 cut(s)	100, 109, 229
NlaIII	CATG	2 cut(s)	196, 230
PleI	GAGTC	1 cut(s)	8
PpsI	GAGTC	1 cut(s)	8
Psp6I	CCWGG	2 cut(s)	220, 244
PspGI	CCWGG	2 cut(s)	220, 244
PspPI	GGNCC	1 cut(s)	212
SaqAI	TTAA	1 cut(s)	125
Sau3AI	GATC	3 cut(s)	100, 109, 229
Sau96I	GGNCC	1 cut(s)	212
SchI	GAGTC	1 cut(s)	8
ScrFI	CCNGG	3 cut(s)	67, 222, 246
SfaNI	GCATC	1 cut(s)	90
SinI	GGWCC	1 cut(s)	212
Sse9I	AATT	2 cut(s)	5, 118
StyD4I	CCNGG	3 cut(s)	65, 220, 244
StyI	CCWWGG	1 cut(s)	192
TasI	AATT	2 cut(s)	5, 118
Tru1I	TTAA	1 cut(s)	125
Tru9I	TTAA	1 cut(s)	125
TspDTI	ATGAA	1 cut(s)	147
VpaK11BI	GGWCC	1 cut(s)	212

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.