MD15G1087700.v1.1

Prolyl oligopeptidase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0012367
Physical Location & Seq
Reverse (-)
6108179 .. 6108401
223 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1087700.v1.1.491

Sequence Viewer

Length: 135 bp
ATGAAGGAGAACAACACGGTTTCCGTAAGCACTAAGTTCACGCTGGAACAACAAATGATCGTCTTTTCACGTTTAGTCGGACGCTTCAAGGTTGCAGAAGAGATTACCCCAACCAGAATTGATAACTTGGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S9

Protein Analysis

45

Amino Acids

5.09

Weight (kDa)

6.14

Isoelectric Point (pI)

23.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012367)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G36210
fragaria_vesca FvH4_2g34950
malus_domestica MD08G1107000.v1.1 MD08G1107200.v1.1 MD15G1087700.v1.1 MD15G1087800.v1.1
prunus_persica Prupe.1G441500_v2.0.a1
pyrus_communis pycom08g08900 pycom08g08910 pycom15g08240
rosa_chinensis RchiOBHm_Chr6g0307051
rosa_laevigata RLG00000010738
rosa_multiflora Rmu_sc0005634.1_g000006
rosa_roxburghii Rroxscaffold_7G00161200
rosa_rugosa Rorug06G0355500
rosa_samantha Rh6AG467000 Rh6CG482500 Rh6DG468800
rosa_wichuraiana Rw6G040710

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 88
Bsp143I GATC 1 cut(s) 57
BssMI GATC 1 cut(s) 57
Bst4CI ACNGT 1 cut(s) 19
Bst6I CTCTTC 1 cut(s) 93
BstDEI CTNAG 1 cut(s) 33
BstKTI GATC 1 cut(s) 60
BstMBI GATC 1 cut(s) 57
CseI GACGC 1 cut(s) 90
DdeI CTNAG 1 cut(s) 33
DpnI GATC 1 cut(s) 59
DpnII GATC 1 cut(s) 57
Eam1104I CTCTTC 1 cut(s) 93
EarI CTCTTC 1 cut(s) 93
HgaI GACGC 1 cut(s) 90
Hpy166II GTNNAC 1 cut(s) 39
Hpy188I TCNGA 1 cut(s) 80
Hpy8I GTNNAC 1 cut(s) 39
HpyCH4III ACNGT 1 cut(s) 19
HpyCH4IV ACGT 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 95
HpyF3I CTNAG 1 cut(s) 33
HpySE526I ACGT 1 cut(s) 70
Kzo9I GATC 1 cut(s) 57
LpnPI CCDG 2 cut(s) 29, 127
MaeII ACGT 1 cut(s) 70
MalI GATC 1 cut(s) 59
MboI GATC 1 cut(s) 57
MboII GAAGA 1 cut(s) 110
MluCI AATT 1 cut(s) 117
MmeI TCCRAC 1 cut(s) 58
MseI TTAA 1 cut(s) 133
NdeII GATC 1 cut(s) 57
SaqAI TTAA 1 cut(s) 133
Sau3AI GATC 1 cut(s) 57
SetI ASST 2 cut(s) 73, 93
SgeI CNNG 6 cut(s) 28, 52, 56, 81, 100, 126
Sse9I AATT 1 cut(s) 117
TaaI ACNGT 1 cut(s) 19
TaiI ACGT 1 cut(s) 73
TasI AATT 1 cut(s) 117
Tru1I TTAA 1 cut(s) 133
Tru9I TTAA 1 cut(s) 133
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.