MD15G1242000.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0006081
Physical Location & Seq
Forward (+)
19930893 .. 19932441
1549 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1242000.v1.1.491

Sequence Viewer

Length: 159 bp
ATGTCTCGGTGTTTTCCGTACCCTCCTCCTGGGTACGTGAAGAAGGGGATCCGCGATGAGGCCCTGATCGATTCGATTAAGGATCAGATACATAGCACCTTTAGCCTGGTATTGGGATGTGGCATATGTGGTAGGATTCAAGTTTTCCTTTTCGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.82

Weight (kDa)

8.59

Isoelectric Point (pI)

33.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 54
AciI CCGC 1 cut(s) 52
AclWI GGATC 3 cut(s) 43, 56, 90
AfaI GTAC 2 cut(s) 20, 35
AfiI CCNNNNNNNGG 3 cut(s) 29, 58, 112
AgsI TTSAA 1 cut(s) 140
AjnI CCWGG 2 cut(s) 28, 105
Alw26I GTCTC 1 cut(s) 9
AlwI GGATC 3 cut(s) 43, 56, 90
AoxI GGCC 1 cut(s) 60
AspS9I GGNCC 1 cut(s) 61
BamHI GGATCC 1 cut(s) 48
BciT130I CCWGG 2 cut(s) 30, 107
BcoDI GTCTC 1 cut(s) 9
Bme1390I CCNGG 2 cut(s) 30, 107
BmgT120I GGNCC 1 cut(s) 61
BmiI GGNNCC 1 cut(s) 50
BmrFI CCNGG 2 cut(s) 30, 107
Bsa29I ATCGAT 1 cut(s) 69
BsaAI YACGTR 1 cut(s) 37
BsaJI CCNNGG 1 cut(s) 29
Bsc4I CCNNNNNNNGG 3 cut(s) 29, 58, 112
BseBI CCWGG 2 cut(s) 30, 107
BseCI ATCGAT 1 cut(s) 69
BseDI CCNNGG 1 cut(s) 29
BseGI GGATG 1 cut(s) 122
BseLI CCNNNNNNNGG 3 cut(s) 29, 58, 112
BseRI GAGGAG 1 cut(s) 15
Bsh1236I CGCG 1 cut(s) 54
BshFI GGCC 1 cut(s) 62
BshVI ATCGAT 1 cut(s) 69
BslI CCNNNNNNNGG 3 cut(s) 29, 58, 112
BsmAI GTCTC 1 cut(s) 9
BsnI GGCC 1 cut(s) 62
Bsp143I GATC 3 cut(s) 48, 66, 82
BspACI CCGC 1 cut(s) 52
BspANI GGCC 1 cut(s) 62
BspDI ATCGAT 1 cut(s) 69
BspFNI CGCG 1 cut(s) 54
BspLI GGNNCC 1 cut(s) 50
BspPI GGATC 3 cut(s) 43, 56, 90
BssECI CCNNGG 1 cut(s) 29
BssMI GATC 3 cut(s) 48, 66, 82
Bst2UI CCWGG 2 cut(s) 30, 107
BstBAI YACGTR 1 cut(s) 37
BstF5I GGATG 1 cut(s) 122
BstFNI CGCG 1 cut(s) 54
BstKTI GATC 3 cut(s) 51, 69, 85
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 3 cut(s) 48, 66, 82
BstMWI GCNNNNNNNGC 1 cut(s) 102
BstNI CCWGG 2 cut(s) 30, 107
BstSCI CCNGG 2 cut(s) 28, 105
BstUI CGCG 1 cut(s) 54
BstX2I RGATCY 1 cut(s) 48
BstYI RGATCY 1 cut(s) 48
Bsu15I ATCGAT 1 cut(s) 69
BsuRI GGCC 1 cut(s) 62
BsuTUI ATCGAT 1 cut(s) 69
BtgZI GCGATG 1 cut(s) 69
BtsCI GGATG 1 cut(s) 122
Cfr13I GGNCC 1 cut(s) 61
ClaI ATCGAT 1 cut(s) 69
Csp6I GTAC 2 cut(s) 19, 34
CviJI RGCY 2 cut(s) 62, 105
CviKI_1 RGCY 2 cut(s) 62, 105
CviQI GTAC 2 cut(s) 19, 34
DpnI GATC 3 cut(s) 50, 68, 84
DpnII GATC 3 cut(s) 48, 66, 82
EcoO109I RGGNCCY 1 cut(s) 61
EcoRII CCWGG 2 cut(s) 28, 105
FaiI YATR 3 cut(s) 93, 125, 127
FalI AAGNNNNNCTT 1 cut(s) 132
FauNDI CATATG 1 cut(s) 125
FokI GGATG 1 cut(s) 129
HaeIII GGCC 1 cut(s) 62
HinfI GANTC 2 cut(s) 71, 136
Hpy188I TCNGA 1 cut(s) 87
HpyAV CCTTC 1 cut(s) 37
HpyCH4IV ACGT 1 cut(s) 36
HpyF10VI GCNNNNNNNGC 1 cut(s) 102
HpySE526I ACGT 1 cut(s) 36
Kzo9I GATC 3 cut(s) 48, 66, 82
LpnPI CCDG 5 cut(s) 15, 42, 77, 92, 119
MaeII ACGT 1 cut(s) 36
MalI GATC 3 cut(s) 50, 68, 84
MboI GATC 3 cut(s) 48, 66, 82
MboII GAAGA 1 cut(s) 52
MflI RGATCY 1 cut(s) 48
MnlI CCTC 3 cut(s) 33, 36, 52
MseI TTAA 1 cut(s) 78
MspR9I CCNGG 2 cut(s) 30, 107
MvaI CCWGG 2 cut(s) 30, 107
MvnI CGCG 1 cut(s) 54
MwoI GCNNNNNNNGC 1 cut(s) 102
NdeI CATATG 1 cut(s) 125
NdeII GATC 3 cut(s) 48, 66, 82
NlaIV GGNNCC 1 cut(s) 50
PfeI GAWTC 2 cut(s) 71, 136
Ppu21I YACGTR 1 cut(s) 37
Psp6I CCWGG 2 cut(s) 28, 105
PspGI CCWGG 2 cut(s) 28, 105
PspN4I GGNNCC 1 cut(s) 50
PspPI GGNCC 1 cut(s) 61
PsuI RGATCY 1 cut(s) 48
RsaI GTAC 2 cut(s) 20, 35
RsaNI GTAC 2 cut(s) 19, 34
SaqAI TTAA 1 cut(s) 78
Sau3AI GATC 3 cut(s) 48, 66, 82
Sau96I GGNCC 1 cut(s) 61
ScrFI CCNGG 2 cut(s) 30, 107
SetI ASST 2 cut(s) 39, 101
SgeI CNNG 9 cut(s) 18, 41, 42, 49, 65, 76, 118, 119, 152
SsiI CCGC 1 cut(s) 52
StyD4I CCNGG 2 cut(s) 28, 105
TaiI ACGT 1 cut(s) 39
TaqI TCGA 2 cut(s) 69, 74
TfiI GAWTC 2 cut(s) 71, 136
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TspGWI ACGGA 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.