MD15G1265900.v1.1

Lysine histidine transporter-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
22809701 .. 22826062
16362 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1265900.v1.1.491

Sequence Viewer

Length: 273 bp
ATGGATGATGAAATCGTTGCAACGGAAAGAAAAAAGAAGTCTGATATGGATTTGATCAAGATTATACAATGCTATGACTCCAAGCAACAAAAGTTCAAATTTGGAGATTATGAGCCAAAAGCAATAACAAGTGAAGACGTTGTTGAAATATTTGGATTGAACAACCAAGGGGTTGAACTACCAAACACAGACAAATTCACAAAGAACATGAAGGACAACTTTGTCAAAACATATTTCGTGAACCAAAAAATAGTGAAAAAAGGACATTCTTGA

Protein Analysis

91

Amino Acids

10.48

Weight (kDa)

7.78

Isoelectric Point (pI)

19.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 221
AcsI RAATTY 2 cut(s) 98, 194
AgsI TTSAA 4 cut(s) 97, 146, 160, 176
ApoI RAATTY 2 cut(s) 98, 194
BbsI GAAGAC 1 cut(s) 141
BclI TGATCA 1 cut(s) 54
BpiI GAAGAC 1 cut(s) 141
BsaJI CCNNGG 1 cut(s) 166
BseDI CCNNGG 1 cut(s) 166
BseGI GGATG 1 cut(s) 10
Bsp143I GATC 1 cut(s) 54
BssECI CCNNGG 1 cut(s) 166
BssMI GATC 1 cut(s) 54
BssT1I CCWWGG 1 cut(s) 166
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 1 cut(s) 57
BstMBI GATC 1 cut(s) 54
BstV2I GAAGAC 1 cut(s) 141
BtsCI GGATG 1 cut(s) 10
CviAII CATG 1 cut(s) 208
CviJI RGCY 1 cut(s) 115
CviKI_1 RGCY 1 cut(s) 115
DpnI GATC 1 cut(s) 56
DpnII GATC 1 cut(s) 54
DrdI GACNNNNNNGTC 1 cut(s) 221
DseDI GACNNNNNNGTC 1 cut(s) 221
Eco130I CCWWGG 1 cut(s) 166
EcoT14I CCWWGG 1 cut(s) 166
ErhI CCWWGG 1 cut(s) 166
FaeI CATG 1 cut(s) 211
FaiI YATR 6 cut(s) 47, 65, 75, 111, 209, 232
FalI AAGNNNNNCTT 2 cut(s) 203, 235
FatI CATG 1 cut(s) 207
FbaI TGATCA 1 cut(s) 54
FokI GGATG 1 cut(s) 17
Hin1II CATG 1 cut(s) 211
HinfI GANTC 1 cut(s) 77
Hpy166II GTNNAC 1 cut(s) 241
Hpy188I TCNGA 1 cut(s) 43
Hpy188III TCNNGA 3 cut(s) 58, 238, 270
Hpy8I GTNNAC 1 cut(s) 241
HpyAV CCTTC 1 cut(s) 205
HpyCH4IV ACGT 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 20
HpySE526I ACGT 1 cut(s) 138
Hsp92II CATG 1 cut(s) 211
Ksp22I TGATCA 1 cut(s) 54
Kzo9I GATC 1 cut(s) 54
MaeII ACGT 1 cut(s) 138
MalI GATC 1 cut(s) 56
MboI GATC 1 cut(s) 54
MboII GAAGA 1 cut(s) 146
MluCI AATT 2 cut(s) 98, 194
MlyI GAGTC 1 cut(s) 71
NdeII GATC 1 cut(s) 54
NlaIII CATG 1 cut(s) 211
PleI GAGTC 1 cut(s) 71
PpsI GAGTC 1 cut(s) 71
Sau3AI GATC 1 cut(s) 54
SchI GAGTC 1 cut(s) 71
SetI ASST 1 cut(s) 141
SgeI CNNG 6 cut(s) 70, 94, 141, 179, 220, 250
Sse9I AATT 2 cut(s) 98, 194
SspI AATATT 1 cut(s) 150
StyI CCWWGG 1 cut(s) 166
TaiI ACGT 1 cut(s) 141
TasI AATT 2 cut(s) 98, 194
TspDTI ATGAA 2 cut(s) 24, 224
TspGWI ACGGA 1 cut(s) 38
XapI RAATTY 2 cut(s) 98, 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.