pycom15g25920

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
20564392 .. 20564745
354 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g25920.1

Sequence Viewer

Length: 354 bp
ATGTTTAACCAATTTGAAAAATGTATGGGCATGGAACATAAGAGGTATATAATGCTCAAACATATGAAGATGCATGCAATTGACAGTCTCCAAACAACTTCTGTAGTTTCAGGTCAAACAACCGGAAAACTCAAAAAAGACATTGAAAAGCTTCAAGAAGAACGAGAGTTGAACAAGAAGAAAATCAGTGATATGGATGCTGAAATCCTACAATTATGGTTGAAGAACATTGAAACTTCAAGAAAAGTCAATCAACTTCTCAATGACATTGGAATCCTGAAGAATAAGCTACAAGAAAATCAAACAAAAGTTTTAGAAGTTCTAATTGATGCTCAGTCGAGAAGAAGCCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.73

Weight (kDa)

9.38

Isoelectric Point (pI)

69.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 299
AgsI TTSAA 7 cut(s) 17, 146, 155, 172, 223, 233, 240
AluBI AGCT 2 cut(s) 151, 289
AluI AGCT 2 cut(s) 151, 289
Alw26I GTCTC 1 cut(s) 92
Asp700I GAANNNNTTC 1 cut(s) 150
BcoDI GTCTC 1 cut(s) 92
BfmI CTRYAG 1 cut(s) 102
BmsI GCATC 3 cut(s) 60, 187, 319
BsaWI WCCGGW 1 cut(s) 122
BseGI GGATG 1 cut(s) 202
BseMII CTCAG 1 cut(s) 347
BsiSI CCGG 1 cut(s) 123
BsmAI GTCTC 1 cut(s) 92
BspCNI CTCAG 1 cut(s) 346
Bst4CI ACNGT 1 cut(s) 86
BstC8I GCNNGC 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 333
BstF5I GGATG 1 cut(s) 202
BstMAI GTCTC 1 cut(s) 92
BstNSI RCATGY 1 cut(s) 77
BstSFI CTRYAG 1 cut(s) 102
BtsCI GGATG 1 cut(s) 202
BtsIMutI CAGTG 1 cut(s) 193
Cac8I GCNNGC 1 cut(s) 75
CviAII CATG 2 cut(s) 31, 74
CviJI RGCY 3 cut(s) 151, 289, 348
CviKI_1 RGCY 3 cut(s) 151, 289, 348
DdeI CTNAG 1 cut(s) 333
Eco57I CTGAAG 1 cut(s) 299
EcoT22I ATGCAT 1 cut(s) 75
FaeI CATG 2 cut(s) 34, 77
FatI CATG 2 cut(s) 30, 73
FauNDI CATATG 1 cut(s) 63
FokI GGATG 1 cut(s) 209
HapII CCGG 1 cut(s) 123
Hin1II CATG 2 cut(s) 34, 77
HindIII AAGCTT 1 cut(s) 149
HinfI GANTC 1 cut(s) 273
HpaII CCGG 1 cut(s) 123
Hpy188III TCNNGA 4 cut(s) 155, 240, 277, 339
HpyCH4III ACNGT 1 cut(s) 86
HpyCH4V TGCA 2 cut(s) 73, 77
HpyF3I CTNAG 1 cut(s) 333
Hsp92II CATG 2 cut(s) 34, 77
LpnPI CCDG 3 cut(s) 96, 136, 290
LweI GCATC 3 cut(s) 60, 187, 319
MboII GAAGA 6 cut(s) 79, 170, 190, 235, 292, 354
MfeI CAATTG 1 cut(s) 78
MluCI AATT 4 cut(s) 11, 78, 212, 324
MnlI CCTC 1 cut(s) 36
Mph1103I ATGCAT 1 cut(s) 75
MroXI GAANNNNTTC 1 cut(s) 150
MseI TTAA 1 cut(s) 6
MspI CCGG 1 cut(s) 123
MunI CAATTG 1 cut(s) 78
NdeI CATATG 1 cut(s) 63
NlaIII CATG 2 cut(s) 34, 77
NsiI ATGCAT 1 cut(s) 75
NspI RCATGY 1 cut(s) 77
PaeI GCATGC 1 cut(s) 77
PdmI GAANNNNTTC 1 cut(s) 150
PfeI GAWTC 1 cut(s) 273
SaqAI TTAA 1 cut(s) 6
SetI ASST 4 cut(s) 47, 115, 153, 291
SfaNI GCATC 3 cut(s) 60, 187, 319
SfcI CTRYAG 1 cut(s) 102
SphI GCATGC 1 cut(s) 77
Sse9I AATT 4 cut(s) 11, 78, 212, 324
TaaI ACNGT 1 cut(s) 86
TaqI TCGA 1 cut(s) 338
TasI AATT 4 cut(s) 11, 78, 212, 324
TfiI GAWTC 1 cut(s) 273
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TscAI CASTG 1 cut(s) 193
TspDTI ATGAA 1 cut(s) 80
TspRI CASTG 1 cut(s) 193
XceI RCATGY 1 cut(s) 77
XmnI GAANNNNTTC 1 cut(s) 150
Zsp2I ATGCAT 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.