pycom15g25910

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
20562859 .. 20563296
438 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g25910.1

Sequence Viewer

Length: 438 bp
ATGGCACATGAGCTTGTTGTTCTAAAGTCAGATTTGACATCATTGTTTATCGATGGAGCGATTGACTCGAATATAATTGATGCATCTTTCTTCATCATGTCAGAAAATGAAACAAAAACAGGACAAGAGCAAAATCTATATCTTCCTTCCTTCATCTTTGTAAGTGCAAACAAGTTTGTTTACAACAAATTTCTATTTGTCAATTTCATAAATAGTAAAAAAAAAGTTAAGTTATTGTTTCAGAATGACATGGAGAAAACAAATTCAGAAAGTGACCAGCAGTATATTGATCGAATGTTGAAGAGGCTCTTGGAAGAAAATGTCGACAAAGTCGGAAAGGTCTTCATGATAATAAAGCATTACTTCCACTTCACCCTAGTAGTTTGGGATATTAAAATGGAAAAATGGCACACTACAATTCCAAACTATCAAGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

146

Amino Acids

17.12

Weight (kDa)

6.41

Isoelectric Point (pI)

28.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 324
AcsI RAATTY 2 cut(s) 188, 262
AgsI TTSAA 1 cut(s) 301
AjuI GAANNNNNNNTTGG 2 cut(s) 293, 325
AluBI AGCT 1 cut(s) 13
AluI AGCT 1 cut(s) 13
ApoI RAATTY 2 cut(s) 188, 262
AsuHPI GGTGA 1 cut(s) 364
BbsI GAAGAC 1 cut(s) 334
BccI CCATC 1 cut(s) 47
BfaI CTAG 1 cut(s) 377
BmsI GCATC 2 cut(s) 70, 92
BpiI GAAGAC 1 cut(s) 334
Bsa29I ATCGAT 1 cut(s) 51
BseCI ATCGAT 1 cut(s) 51
BshVI ATCGAT 1 cut(s) 51
Bsp143I GATC 1 cut(s) 289
BspDI ATCGAT 1 cut(s) 51
BspHI TCATGA 1 cut(s) 345
BssMI GATC 1 cut(s) 289
Bst6I CTCTTC 1 cut(s) 296
BstKTI GATC 1 cut(s) 292
BstMBI GATC 1 cut(s) 289
BstV2I GAAGAC 1 cut(s) 334
Bsu15I ATCGAT 1 cut(s) 51
BsuTUI ATCGAT 1 cut(s) 51
CciI TCATGA 1 cut(s) 345
ClaI ATCGAT 1 cut(s) 51
CviAII CATG 4 cut(s) 8, 97, 250, 346
CviJI RGCY 2 cut(s) 13, 307
CviKI_1 RGCY 2 cut(s) 13, 307
DpnI GATC 1 cut(s) 291
DpnII GATC 1 cut(s) 289
Eam1104I CTCTTC 1 cut(s) 296
EarI CTCTTC 1 cut(s) 296
EcoT22I ATGCAT 1 cut(s) 85
FaeI CATG 4 cut(s) 11, 100, 253, 349
FaiI YATR 8 cut(s) 9, 74, 98, 139, 209, 251, 285, 347
FalI AAGNNNNNCTT 4 cut(s) 293, 325, 347, 379
FatI CATG 4 cut(s) 7, 96, 249, 345
FblI GTMKAC 1 cut(s) 324
FspBI CTAG 1 cut(s) 377
Hin1II CATG 4 cut(s) 11, 100, 253, 349
HincII GTYRAC 1 cut(s) 325
HindII GTYRAC 1 cut(s) 325
HinfI GANTC 1 cut(s) 65
HphI GGTGA 1 cut(s) 364
Hpy166II GTNNAC 2 cut(s) 181, 325
Hpy188I TCNGA 5 cut(s) 31, 103, 243, 268, 335
Hpy188III TCNNGA 1 cut(s) 346
Hpy8I GTNNAC 2 cut(s) 181, 325
HpyAV CCTTC 2 cut(s) 156, 160
HpyCH4V TGCA 2 cut(s) 83, 167
Hsp92II CATG 4 cut(s) 11, 100, 253, 349
Kzo9I GATC 1 cut(s) 289
LmnI GCTCC 1 cut(s) 56
LpnPI CCDG 2 cut(s) 105, 290
LweI GCATC 2 cut(s) 70, 92
MaeI CTAG 1 cut(s) 377
MaeIII GTNAC 1 cut(s) 272
MalI GATC 1 cut(s) 291
MboI GATC 1 cut(s) 289
MboII GAAGA 5 cut(s) 82, 134, 313, 326, 334
MluCI AATT 5 cut(s) 75, 188, 202, 262, 417
MlyI GAGTC 1 cut(s) 59
MmeI TCCRAC 1 cut(s) 313
MnlI CCTC 1 cut(s) 297
Mph1103I ATGCAT 1 cut(s) 85
MseI TTAA 2 cut(s) 228, 393
NdeII GATC 1 cut(s) 289
NlaIII CATG 4 cut(s) 11, 100, 253, 349
NmuCI GTSAC 1 cut(s) 272
NsiI ATGCAT 1 cut(s) 85
PagI TCATGA 1 cut(s) 345
PflFI GACNNNGTC 1 cut(s) 329
PleI GAGTC 1 cut(s) 59
PpsI GAGTC 1 cut(s) 59
PsyI GACNNNGTC 1 cut(s) 329
SalI GTCGAC 1 cut(s) 323
SaqAI TTAA 2 cut(s) 228, 393
Sau3AI GATC 1 cut(s) 289
SchI GAGTC 1 cut(s) 59
SetI ASST 2 cut(s) 15, 342
SfaNI GCATC 2 cut(s) 70, 92
Sse9I AATT 5 cut(s) 75, 188, 202, 262, 417
SspMI CTAG 1 cut(s) 377
TaqI TCGA 4 cut(s) 51, 68, 292, 324
TasI AATT 5 cut(s) 75, 188, 202, 262, 417
Tru1I TTAA 2 cut(s) 228, 393
Tru9I TTAA 2 cut(s) 228, 393
TseFI GTSAC 1 cut(s) 272
Tsp45I GTSAC 1 cut(s) 272
TspDTI ATGAA 5 cut(s) 82, 123, 142, 196, 334
Tth111I GACNNNGTC 1 cut(s) 329
XapI RAATTY 2 cut(s) 188, 262
XmiI GTMKAC 1 cut(s) 324
XspI CTAG 1 cut(s) 377
Zsp2I ATGCAT 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.