pycom02g20490

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
Physical Location & Seq
Forward (+)
18587004 .. 18587682
679 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g20490.1

Sequence Viewer

Length: 261 bp
ATGCAACCAAAGAAACAGAACATGGCACATGAGCTTGTTGTTCTAAAGTTAGATTTGACATCATTGTTTATCGATGGTGCAATTGACTCAAATATAATTGATGAGTCCTTCTTCATCATGTTAGAAAATGAAACAAAAGATAGACAAGAGCAAAATATGTATCTTCCTTCATCTTTGGACAAAATAGAAGCATTGTACAAGGATTTCAAGGCTGGCCAAACCCTCAAAATAGAGATTGAAAGATGCTTGACTTGTGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.93

Weight (kDa)

4.72

Isoelectric Point (pI)

49.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 214
AfaI GTAC 1 cut(s) 197
AgsI TTSAA 2 cut(s) 208, 239
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
AoxI GGCC 1 cut(s) 214
BalI TGGCCA 1 cut(s) 216
BccI CCATC 1 cut(s) 68
BmsI GCATC 1 cut(s) 233
Bsa29I ATCGAT 1 cut(s) 72
BseCI ATCGAT 1 cut(s) 72
BshFI GGCC 1 cut(s) 216
BshVI ATCGAT 1 cut(s) 72
BsnI GGCC 1 cut(s) 216
Bsp1407I TGTACA 1 cut(s) 195
BspANI GGCC 1 cut(s) 216
BspDI ATCGAT 1 cut(s) 72
BsrGI TGTACA 1 cut(s) 195
BstAUI TGTACA 1 cut(s) 195
BstC8I GCNNGC 1 cut(s) 214
Bsu15I ATCGAT 1 cut(s) 72
BsuRI GGCC 1 cut(s) 216
BsuTUI ATCGAT 1 cut(s) 72
Cac8I GCNNGC 1 cut(s) 214
ClaI ATCGAT 1 cut(s) 72
Csp6I GTAC 1 cut(s) 196
CviAII CATG 3 cut(s) 22, 29, 118
CviJI RGCY 3 cut(s) 34, 212, 216
CviKI_1 RGCY 3 cut(s) 34, 212, 216
CviQI GTAC 1 cut(s) 196
EaeI YGGCCR 1 cut(s) 214
FaeI CATG 3 cut(s) 25, 32, 121
FaiI YATR 6 cut(s) 23, 30, 95, 119, 158, 259
FatI CATG 3 cut(s) 21, 28, 117
HaeIII GGCC 1 cut(s) 216
Hin1II CATG 3 cut(s) 25, 32, 121
HinfI GANTC 2 cut(s) 86, 104
HpyAV CCTTC 2 cut(s) 118, 177
HpyCH4V TGCA 3 cut(s) 4, 80, 257
Hsp92II CATG 3 cut(s) 25, 32, 121
LpnPI CCDG 1 cut(s) 198
LweI GCATC 1 cut(s) 233
MboII GAAGA 2 cut(s) 103, 155
MfeI CAATTG 1 cut(s) 81
MlsI TGGCCA 1 cut(s) 216
MluCI AATT 2 cut(s) 81, 96
MluNI TGGCCA 1 cut(s) 216
MlyI GAGTC 2 cut(s) 80, 113
MnlI CCTC 1 cut(s) 233
Mox20I TGGCCA 1 cut(s) 216
MscI TGGCCA 1 cut(s) 216
Msp20I TGGCCA 1 cut(s) 216
MunI CAATTG 1 cut(s) 81
NlaIII CATG 3 cut(s) 25, 32, 121
PleI GAGTC 2 cut(s) 80, 112
PpsI GAGTC 2 cut(s) 80, 112
RsaI GTAC 1 cut(s) 197
RsaNI GTAC 1 cut(s) 196
SchI GAGTC 2 cut(s) 80, 113
SetI ASST 1 cut(s) 36
SfaNI GCATC 1 cut(s) 233
SgeI CNNG 8 cut(s) 34, 41, 47, 130, 158, 211, 220, 225
Sse9I AATT 2 cut(s) 81, 96
TaqI TCGA 1 cut(s) 72
TasI AATT 2 cut(s) 81, 96
TatI WGTACW 1 cut(s) 195
TspDTI ATGAA 3 cut(s) 103, 144, 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.