pycom15g25900

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
20561942 .. 20562193
252 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g25900.1

Sequence Viewer

Length: 252 bp
ATGCAGATTAGATTGCTGCTTATTTGTCATTCACTTTGCAAACCAACTTCAAGAGGGCAAACCAATAGAATCTACTTTCACAAGGAAGAAGTATTTATAAAGAGAGCTTCAATTGCAACTATATTGGTGAATCATTCGTACAGTTATCCAAATGGACTGAAAAGGTTGTTTGAAGAAAAAAGGGTTGCTAGGAAATATGATTACATTGATGAACTTTTCGGAGATGATGATGATGATCATATTTCATTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.85

Weight (kDa)

7.81

Isoelectric Point (pI)

42.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 98
AfaI GTAC 1 cut(s) 140
AgsI TTSAA 3 cut(s) 51, 111, 173
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
ApeKI GCWGC 1 cut(s) 16
AsuHPI GGTGA 1 cut(s) 139
BbvI GCAGC 1 cut(s) 3
BclI TGATCA 1 cut(s) 235
BfaI CTAG 1 cut(s) 189
BisI GCNGC 1 cut(s) 17
BlsI GCNGC 1 cut(s) 18
BsaBI GATNNNNATC 1 cut(s) 234
Bse8I GATNNNNATC 1 cut(s) 234
BseJI GATNNNNATC 1 cut(s) 234
BseXI GCAGC 1 cut(s) 3
Bsp143I GATC 1 cut(s) 235
BssMI GATC 1 cut(s) 235
Bst4CI ACNGT 1 cut(s) 143
BstKTI GATC 1 cut(s) 238
BstMBI GATC 1 cut(s) 235
BstMWI GCNNNNNNNGC 1 cut(s) 113
BstV1I GCAGC 1 cut(s) 3
Csp6I GTAC 1 cut(s) 139
CviJI RGCY 1 cut(s) 107
CviKI_1 RGCY 1 cut(s) 107
CviQI GTAC 1 cut(s) 139
DpnI GATC 1 cut(s) 237
DpnII GATC 1 cut(s) 235
FaiI YATR 4 cut(s) 98, 122, 198, 240
FbaI TGATCA 1 cut(s) 235
Fnu4HI GCNGC 1 cut(s) 17
Fsp4HI GCNGC 1 cut(s) 17
FspBI CTAG 1 cut(s) 189
GluI GCNGC 1 cut(s) 17
HinfI GANTC 2 cut(s) 69, 130
HphI GGTGA 1 cut(s) 139
Hpy188I TCNGA 1 cut(s) 221
Hpy188III TCNNGA 1 cut(s) 51
HpyCH4III ACNGT 1 cut(s) 143
HpyCH4V TGCA 3 cut(s) 4, 39, 116
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
Ksp22I TGATCA 1 cut(s) 235
Kzo9I GATC 1 cut(s) 235
Lsp1109I GCAGC 1 cut(s) 3
MaeI CTAG 1 cut(s) 189
MalI GATC 1 cut(s) 237
MboI GATC 1 cut(s) 235
MboII GAAGA 2 cut(s) 98, 185
MfeI CAATTG 1 cut(s) 111
MluCI AATT 1 cut(s) 111
MnlI CCTC 1 cut(s) 47
MunI CAATTG 1 cut(s) 111
MwoI GCNNNNNNNGC 1 cut(s) 113
NdeII GATC 1 cut(s) 235
PfeI GAWTC 2 cut(s) 69, 130
PkrI GCNGC 1 cut(s) 18
PsiI TTATAA 1 cut(s) 98
RsaI GTAC 1 cut(s) 140
RsaNI GTAC 1 cut(s) 139
SatI GCNGC 1 cut(s) 17
Sau3AI GATC 1 cut(s) 235
SetI ASST 2 cut(s) 109, 167
SgeI CNNG 3 cut(s) 63, 94, 201
Sse9I AATT 1 cut(s) 111
SspMI CTAG 1 cut(s) 189
TaaI ACNGT 1 cut(s) 143
TasI AATT 1 cut(s) 111
TfiI GAWTC 2 cut(s) 69, 130
TseI GCWGC 1 cut(s) 16
TspDTI ATGAA 2 cut(s) 225, 234
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.